Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PRI1
Systematic Name YIR008C
Description Subunit of DNA primase, which is required for DNA synthesis and double-strand break repair
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRI1	6322198 upstream sequence, from -1000 to -1, size 1000
ATCATTTGTGAATTTTTGCTTTTACTAGAAATATATATCATTTTAAACGAAGCCACATAT
AAACGCTGAACTACACTGTAATTCATCATATAGTAAGCTGTCTTATATACTAAATTATCA
CTTCCAAAATGTAATAAACGTCTTTTGGCAATGGGGTACTCTGTGGTTTGCCCTTTGTAT
TATTTAAGCAATTGAAGTGAGGAATAAGCGGCCGTTCTGCAGTATGTCTTTTCGGGAGAC
TCTTTCTGCTACAGATTTTTGTAGATTCTATATCTACTCCATATTGATACATGCCTTGAT
ATTATTTGTCCGTTGACGACCATCTATAACGCCGGGTTGTTTGGATATAAACATTTTGGT
TTGGTTCTGCGCTCTTGACTTTGATGTGCCCCTATGGCAGCTCTTCTCGGTATATACGTG
CTGCTATGAATAGAGCGTTAAGCCAGTCATAGTGTTTTAGTTTCACTCTTGCTGAACTCA
ACTTTCAAAGGCTTACCAAAGAATCGCTCGCCGTTTAATGAAATCTGGGCCAGACTGGCC
TGGTCGATGGTTCTCATGGTGATAAAGGCTTGGCCCCGCTGTTTCTTGAAATTCATGCTA
ACCTTCAGTACCTCTCCAAACGTAGCAAAGAGCAAAAAAAGGTTTACTCGCAGTCGTTGC
ATATTAATTTTTTCATTAAGCTGGCTCACGTACAGCGTATTTTTAGCTTCCGTTACTGGT
TCAGCCACAGTGTGATGAGTATCGCGATCAATCCTCTGCTTTTTCCTTGCTGGTTCAACC
ATTACTATATCCTACGTGTGAATGATGCGTGAGTTTCGAAACAGTTGCTCGGTCAGTGCC
CTTTGCCACTTTTACCTATTGTTTTCTTTCAGTTGAAAAGTTTCATAACGCCAAAAAGAT
AAAAAATTAATCAAAAATACTTTGAAGCTGAAGAGAAAAGCGTGCCATAATACTAGCAAA
AATTAGTTTTAGCAACTCAAAAAACTGTTTTATAAACATC
Chromosomal Coordinates Chr IX from 374306-373077
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator