Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BNR1
Systematic Name YIL159W
Description Formin, nucleates the formation of linear actin filaments, involved in cell processes such as budding and mitotic spindle orientation which require the formation of polarized actin cables, functionally redundant with BNI1
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BNR1	6322032 upstream sequence, from -1000 to -1, size 1000
AACTCGTCTTGATCCTTTCTACTGATCTTGAAATTAGCGGCAACATTCTCATTAGTAATG
CCCATTGGTATTAGACATTTCTTCGCTTCTCGGTTTTTTTGCAGCTCTTCAGAGGAGATC
ATGCCCAAGGGATTGACGTTTTTGTAGTTATTGGTCATTGATTCCACTCCCAGCGCCAAA
CCAATATCAATTTGCCCAACCTTAATCTTGTTGGCAATATCGTTCACCGCCGTTAAACCT
GAAGAACATTGTCTGTTTAAAGCGACAAATGGCGTCGAGTAGGGAATCCCACTTGCCAAG
CATGCAGCCCTGTGTTCTGTAGCACCGGCTCCAACATTGAGAACATTTCCACAGGCAACT
TCTTCGATTAAGTTCAAATCAGCCCTCAAAGGTTCCGGAAACCTCCCGATGAACTCATTG
AGAAAGTTGTATAATAAGTAGTCTGTGTTTACATCTTTGAAGGCACCTTTAAAACCTTTA
CCGATGGCAGACCTGTTAGCAGCCACAATAACTACATCTTCGGGTCTTTTCTCCAGCAAC
GAGTTCTTCCTCTTCGATTCACCCTTACCCATGGCGCTCTCCACCAAATGATCCTTGATA
CTTTGTAGTCTTTGAGACATTGCTTTTATGTAGTGTTATATTCACTCTGTACTCAGAGCC
ACAAGAAATAACCATTCGATTTCAATAGAACTGAGATGCAAAAGTATACCCTATTTATAT
CTCTTCTTTCTAGTAAAACTCCAATAAATTTGAAACCAATAGAGGGAGAAAGGAAAAAAA
AGCTGCGGTGTTAATACTATTATCCCCGTTTCCCTTTGATAGCGCCTTACACGGCGCTAC
CACATCATTACCCTCCTCATGTTGACGCGTCAAGTTTTTTTTCTTTTTTCGCTATTTGTG
GCATAGGTTCAAAACTAGCAAATTCTTGATCTTTTGAAGATTACATAGTGATGATGATCG
TGACACAAAAGCAGATAAAAAAATAGCACAATCATCAGCG
Chromosomal Coordinates Chr IX from 41825-45952
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator