Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SSL2
Systematic Name YIL143C
Alias LOM3, RAD25
Description Component of the holoenzyme form of RNA polymerase transcription factor TFIIH, has DNA-dependent ATPase/helicase activity and is required, with Rad3p, for unwinding promoter DNA; involved in DNA repair; homolog of human ERCC3
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SSL2	6322048 upstream sequence, from -1000 to -1, size 1000
CCGAATATTTTGACCTTGTCTGTATCCAAAGTTGTATTGGCGATTAGAATCTTAGCATTT
TCAATTCTCTTGGGTTGGTTGTTACCAAATTTTTTGGCAAGAATGAAACCTTCGTCAAGG
AACGAATCTGATAGCTTTCCACCAAGAATCTTAATGATCTGAATATGTTCTAAGTTAGTG
GAGCCCTTCAATCTCAAAATAGCATTAGTTGCTAATTCTGCGAAGTGATCCTTATCCTGA
GACAAAATTTTGGAAGATAAAGTAGTCTTGGCAATATGGATCAGATCTTCACGGAACATG
GTCTTATCATGAGAGTTGTCAACAGCCGCTTTCGTTAACGCATCCAATGCGGCTGCTGAA
GCTAGTCGGTAACCTTCAATAATAGTTTGAGGGTGGATTTTGGATTGATCAATCAACTTC
TCTGCTTCTCTAAGCAACTCTGCGCTCAAAACAGTAACACTAGTGGTACCATCTCCAACT
TCGTCATCCTGCACCTTACTGATGTTCACCAACACTTTGGCTGCGGGATTATCCAGCGGA
ATTGACTTCAGAATCGTAGCACCATCGTTTGTTACCATGCAAGTGTTACTGGACGCACTT
TGCAATAATTTATCCATCCCTTTTGGGCCTAATGTGCTTTTCACCAAATCACCCACGGCA
ATGGCACCGACAAACGCCGACAAACGGGCGTTTTCCGCTCTTTCTTCTGTAACCTGGTCT
CCAAATATCTGTACACTCATCCTGAATCTTTTGAGCTTTGTACGACTGACTCTTCTTGCC
TATTTAATGGCCACCTTTCATCCTCTTTTTTATTGCTCTGCTCTTGTCTTTTAAACTCGC
CACCGCGAAGAGAAAAAAATTTCAGATCGTTAGAAACGAGGTTTTTCTTCTAAGAAGTAT
AAGGAAAAAGGTCCTTAGTAAGGATAGATAATAGTAATGATATCTACATTATTTAGTAAA
AGTAGCATCTACTGACGTTGGAATCAGTGGAAGATAAATC
Chromosomal Coordinates Chr IX from 83041-80510
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator