Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name OM45
Systematic Name YIL136W
Description Protein of unknown function, major constituent of the mitochondrial outer membrane; located on the outer (cytosolic) face of the outer membrane
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OM45	6322055 upstream sequence, from -1000 to -1, size 1000
GTAAAACTGTCTTCGATAGAAGCTAAGGTGGTGGAGTTCGGATTGAATTTCAAATGGATT
ATGGCGGATCCTTTGAAATTGGGCGACGACTGCTTAGGGTCAATTTCTAGACGCAACTCA
TAGTGACTAGGCACCACCGGATTCTCTAAAGATAACAAATTATCAGACATGATGGTTAGT
GATGATCAACCTGGCGTTATATATCCTTTACACGTCTTCGGACCTTTTTTTTGTATAGCA
CATCCAGGAATGGTTTGACTGCAAAACTCGTTTTTCACTGAAAAATTACCGGCGAATTGT
ATAATAGAAAGGATCGATTTATACTAAAGAAAAGAAGGATTAATATACAAGACTACAACC
AAGGGTGGTACCTCACTTGAAGGGGGTTCTCAAAGTACTCGAGAATTTTGATATTCTGTC
CTGTGTGTGCTGAGCCGTTCCAGCCAGTCTTGTTCCAGAAATATGTTGACAAAATTGAAG
TTCGTAAATATATATACATTTCATATAATAATTGACAAGCTGATACATACGGTGTGCGGA
CGGTTACATTAATGCAGGAATCTATAAATGCTATGGCCAGCTGGCGTCCTTCTGTTATGC
AGATTTCTTAAAATAATTGGCATATTGGTGGTAAACATGAAATGTGAAGACGTTGCCCCT
CGTCATAGGTAAGCGGTGGTCATCACAACCATCAGCGGTGACAATAACACAGCAAACAGT
CTTGTTTGACTCTCCTGCCTGCATGGTGTTTGAAAGTGAATCGTCAGGATTTGCAACAAC
CAATAGTGTACTGCTATTCGCAGGAGCACAAGCTCGCCGGTGGCCCGTGTGGGTTAAGGG
AGGAGTTTGTTGACCCTTATTTTGTCGAGTTCCTTGAAGAGGAGTATATATAAGGGGAAA
CGGTTCTTGCTAAAGTCCTGCTTCTTTGCCCTTTCTTGAAATAAAGGGTATTTTTGATTG
GCCAGTAACGTTAATCATTTAATAAAACAAGCAGATAAGG
Chromosomal Coordinates Chr IX from 93619-94800
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator