Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name QDR1
Systematic Name YIL120W
Description Multidrug transporter of the major facilitator superfamily, required for resistance to quinidine, ketoconazole, fluconazole, and barban
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>QDR1	6322071 upstream sequence, from -1000 to -1, size 1000
GTGCAACGTATCATAGAAAATGATCCCAAATACACCTTTAATATCTTCAAGGCGAGGTTG
CAACCCGCATTTGTTACCTTGCTTTTAAGCAGTAGCGGATTTTGTGCGTACGGATGGTGC
ATTACTGTCAAAGCCCCTTTAGCGGCCGTTCTTTGCATGAGTGGATTTGCGTCGCTGTTT
TCCAATTGCATTTTGACTTTTTCAACAACTCTAATAGTTGATCTTTTTCCCACGAAGACA
TCTACGGCTACGGGATGTTTAAACCTTTTCAGATGCATTCTATCTGCTGTGTTTATAGCT
GCATTGAGTAAAATGGTAGAAAAAATGAAATTCGGAGGTGTTTTTACATTTTTGGGGGCT
TTAACCTCCTCGTCATCGATCCTCTTATTTATTCTCTTGAGAAAAGGTAAAGAATTAGCC
TTTAAGAGGAAAAAGCAAGAACTGGGAGTAAATTAAGAAGTAAAGCTTCTTGAATCAAAG
GAAAATGTTCCTTTTGATCGCTCCACTACCGAGAAAGAGGAATTGGTGTGATAAGTCTTC
TCAAATAGAAAGTAATAGTAAGTATTTTTTTTTTTTTAATCTGAACTCTGTAATAACTAA
AATTAGAGTTAGCAGCACGATTCACTAACATAGAACGGCTAGTACTGAGTTTTGCCTTTA
TTATTCTCCGCCATTTTTTGCCAAGGCCGAAAATATGCTGGAGGTGCGAAATTCGGAGAT
TCGGGTTTCATGTTTCTGGCCCGGTTGTTAACGGACCCTTTATCTCATCTTCTGATCTTG
GAGTTTCTTCTAGTTGATAAAACCATGGTGAAGCTGAAAGGTTTGAAGAATCTCTATCAC
TGTAGCAAAAAAATCTTCTTACAACAAAAAAAGTAAGCAAGCAATCAGCGTTCAAAGGAA
CTTATTCTTGCTTAAAAAAAGTGATAATCTCTTAGCACTACCATCTTCTATTAATAAAAA
AATAACAGATAGCTCATGAAGAGACTTCTATAAGTAAATC
Chromosomal Coordinates Chr IX from 134417-136108
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator