Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPB3
Systematic Name YIL021W
Description RNA polymerase II third largest subunit B44, part of central core; similar to prokaryotic alpha subunit
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPB3	6322168 upstream sequence, from -1000 to -1, size 1000
AAACCCCTTAATTGTTGTCATGAGGAAAATAACCAACAAAGTGGGCGGTTTCTTTGCAGA
AACAGAATCCTCCCGTGTTTACAGTCAATTTAAGCTAATGGACCCAACCTTTTCGAACGA
AAGCTTCACCAGACACTTAAGAGAATACATTGTTCCCGAGATTCTCGAAGCGTATGTGAA
AGGCGATGTCAAAGTTCTCAAAAAATGGTTCAGCGAGGCGCCATTCAATGTTTACGCCGC
CCAACAGAAAATCTTCAAAGAACAGGATGTTTACGCCGATGGCCGTATCCTAGATATCAG
GGGCGTTGAAATAGTGAGTGCAAAGTTATTGGCTCCCCAAGACATCCCAGTCTTGGTGGT
CGGGTGTAGAGCACAAGAAATCAACCTTTACAGGAAAAAGAAAACTGGCGAGATTGCGGC
TGGTGACGAAGCTAATATCTTGATGAGCTCTTATGCCATGGTTTTCACCAGAGACCCAGA
GCAAATCGACGATGACGAAACAGAAGGGTGGAAGATCTTGGAGTTTGTGCGCGGGGGTTC
TAGACAATTCACCTGATTGGTTTCGATGTACTCTTTTGTTTTCTTTTCCTTTTCCTTCCT
ATTCCGCTTGTAAATAACTCCGTTATGTCTCACCTTCGATCCCCACTTTTTCTTTTGGAA
TACTGCATCAAATAGGAAGAGAGAAAAAAGGAAATCATATCCCAATATATTTGAACATAC
GACACGATATACCTTATATAGTATCATCTGTACTAATAGTACTATAACTAATACTTCTTG
ACGGACAAGCTTCGCAACTCGTTCGCAATGACCAAGTTTGGCTTTCGGGAAGCAAAGTGG
AAAAAAATGAAAAATAAACTAATTGAAGTGGTAAAAAATAAGCTGTGTGTGTGCATATAC
ATCGTAAGTGCGTTGGCTGTTCTGTGGAAAAGGGAGACACTTTTTATATCAGGTGCAAAG
GCTTCGTACCAGCGTTGAAAAACTAAAACAATATTGAAAA
Chromosomal Coordinates Chr IX from 312905-313861
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator