Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HIS6
Systematic Name YIL020C
Description Phosphoribosyl-5-amino-1-phosphoribosyl-4-imidazolecarboxiamide isomerase, catalyzes the fourth step in histidine biosynthesis; mutations cause histidine auxotrophy and sensitivity to Cu, Co, and Ni salts
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HIS6	6322169 upstream sequence, from -1000 to -1, size 1000
ATCATTCCTCTTCTAATATGCATGGGTACTTTTTCCAGCTTATTTATTTTGTCCTGATGA
CCATTCACCCTTGAGAGTCTATTCAGTCTCATTTCGAGTGTACGCGATCTGGCCTTCCCA
ATAACTTGATCATCCTGGTATACTATGCCATCATCATTTCCACCACCCATACTCTGTAGA
GTCAACGATACACCACTGTTTGTAGAACCACTTCCACCGTTATTGAAAGCGCTCAATAAG
TGAGACTCTCTCAGAAATTGCTGCAACTCCAGGTCGTTTTGTAAATTTTCCGCCTCCAAA
GTCTCATCTTCTTTTTCTTCCTTGGCTTCAGTACTCTCCAATTTTTTGTTTATTTGAGTT
AAAGTTTTGCCGCTTCTCAAAAGTTTCTGTGTCTTCTTACTTGGAGGAACATAAACGTCA
CTAGGCCCGTTGAATCTAATGACCTTTGGTTGAGTTTTCGGTTTGGAATCTTGATTATTT
TCTTCCGCGGTTTCGTTACCGCTATCTTCATCAGAAGAATTAGAACTTTCTATAGTACCA
TCCTTGAAATCACTACCATGATCGGAATTGTCAATTTCATCACCTGAACTGTCTCTGGTA
TCTACTTCAGTTCGTATATTTTTTGTTTTATCTTCGAACCCCATGGACTCTAAAGATCCG
AACTGACTTTCAAAAGCTTTTCTTTGAAGCTCCATTTGTTTTATATAGTCGTCATCATCA
AGGGTCATCTTTTTATGGCTTTTGGGTCATTTGTACTCTCAATATTGTTATAACTGTTCC
TGCCATCGTTAATGTATACTCATCTCATCGCTCAAAATTTTTCTAGGAACGGAACGGTCG
CATGAGACGAATGACGAAAATTCAGCACAGGGTCCATTGCCAAGATTGAGCCATGTCTAG
TGTGCAGAGTCATACGGAATAATTTGAGAATCCTCGCCTGCAAATTCACAATATCTTCGA
AACTGCGCATAAGAAGGCTGGGGGTATATACTAGAAAAAA
Chromosomal Coordinates Chr IX from 314820-314035
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator