Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FAA3
Systematic Name YIL009W
Description Long chain fatty acyl-CoA synthetase, activates imported fatty acids; green fluorescent protein (GFP)-fusion protein localizes to the cell periphery
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FAA3	6322182 upstream sequence, from -1000 to -1, size 1000
AGCTCAACAATAGAGCGCCAAAAGTTTACCGGAACGAACCATCATTGTTTACAGGCAAGC
ACCCATTTGGAAGGGTACGTAAACTAAATAAATAAGACAAGAAATTTTTTTTATATCTGG
AATTTCCTTTGCATTTTAGTGATCCCACCATTACAGATAACTAAACCAGGATAAAAAACA
AAAATAATGACATTAATGATACCTTAACTAACGTATAGCAAGCGAAGCAACCACCCATCA
GATTTTTGTCCCCGTTTGGAAACTGGAATGCTATGACCACTTTTATCACTACAGCTAACC
ACTTGTCGGAATGAAGATACGAAAGAGAAATCTTTATTGGACCACTTTTTCTTTCGCTAG
AGGTCCTACCTAGCGTATTGCACCCAAGTGATTATTGCGACCTCTGAGTGTCAGAAACTT
ACGAAGTAAAATTCATAGTTGTGCCTTTCGTCAAGAATCGGAAAGCGTAAAAATAGGCTA
CGGTCTTTGTCAAGGCGAAATTTTGGAGATTTCAGACGCATGATACCAGCAGTTTTTGGT
AATATACTTTTTCAGGTAAAAGCTTTCTACGGCCACTGAAAGTAATGCAGAAGCTTAAGG
CTACAGATGAAATGGCCGACCCAAACTAACCAAGCACAACATCAATTACAGAACCGACAA
TCGAAAATCCTAAAAAAAAAGAACATCGAGTGAACTTTTCGTTATCTCAAAGCTTTAAAG
TTAAAAGTGGCAGAAGCCTTGGCTATTCTGTTTCTCTCTTAGATTCTCGCACGACAGCAT
CGAGCGAAGTTGCAAAACCATATATTTCAGTTCTCTAAACGATCTTTCCCCGAACTCCAA
TCGAAATAGACTTAACCCGCAACATAACTGACATTCTTCCTCTTTTTTTTTTTTTTTTTT
TTTTTTTGCTATTTGCTTTCTGCATGCATAAAAGCGAGACTAGCGTATTAACACTTTATC
ACTTTCCCTCTCTTCCTGAAGCTGACATGAGCATACATCA
Chromosomal Coordinates Chr IX from 339344-341428
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator