Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name Uncharacterized
Systematic Name YHR214C-E
Description Putative protein of unknown function; identified by gene-trapping, microarray-based expression analysis, and genome-wide homology searching
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YHR214C-E_YHR214C-E	YHR214C-E upstream sequence, from -1000 to -1, size 1000
TTGACCGAATTGGCAAGTGTGGTTTCCATTTCTAGGTTTTTGGTGTCACGAATGAAAAAT
TCGTAGTCATCGTTCAAGAAAGACAATGCTCCGCTGAATTGACCGGTATAGTTACTCAAT
TTGTACCACGTTGTCATGATACTTTTGGCTTTGCTGACAGTGGGGTATCTTTCACCGTGT
CTACCAACCATTTGCACTTGCTTCATTTCACAACTTTCCGGCAAATCACGAGAAATACCA
TAATCACCAGGGAAAGAGTAGTATGGCCCAGAACCACCCAAAAATGGGAAAATTTCCGTT
TGAGTTCCGATTTTGTCAATGTCAGATAACTTTCCGAGGGGTATGGTACCTGCATTAACC
AAAGAAGCGGCTAAAATTGAATAAACGGCTGACTTCAACATTGGTATTTCTGATGATGTT
CTTGCTCTCTTTGCTGTTGTTGTTCCTCTTCTTCTTCTTCTTCTTCCTACTTTACAACCA
AGGCGAAACTGAGCTTGAATCTATCGAAATGTAAGAGCTTATATACGTTTTACTTGGCAA
TTCGACGCTGTTTATGCTCATTCCAAAACGGGTATAACATATCTGGTGAGATGACCAATT
TGGCAATGTGACGTGCGGAATATGGAATCTCTCCGGTAAACAGGGTCTGAAATTCTGTGT
AATTTGCCTTTTTAAACCCACGTGTGAACGCCAAGATTGTGCGGCTTCGTTTAGGGATGT
GTTCTGTTTTCTATTAACTTTTTACTCTTTCCTTCCTATTTCCTTTTTTTTTTTTTTTTT
TTAGTACACATGAACTACAGAATGTTATGCGAAAACGTGGTAATTTAATAAATACGTGAC
ACAGCGTATAAGAAAAAGCTTATCAAGGTTATCTCTGTCATTAAAACTTTATTAGACACC
CACGATGAATGAAACGATGAAAGTAGATATAAGAAGTAGTCGGAAGTGAGAAAGAGAAAA
TGATAAAAGAACGAAAAAATCCCTTTATTTTCTCATCTTG
Chromosomal Coordinates Chr VIII from 551499-551200
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator