Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FUR1
Systematic Name YHR128W
Description Uracil phosphoribosyltransferase, synthesizes UMP from uracil; involved in the pyrimidine salvage pathway
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FUR1	6321920 upstream sequence, from -1000 to -1, size 1000
CGAAAAAAAAAACCGTAGAACACACTAAAGAAGGATTTAGCGTTGTCAACGGTAAGCTAG
TAAGCAGCAATGACGTCGGTGTACTGTTAAGAGAAGCACAGGGTGCTATCGATAAAAGAA
CTAATGTTTCCCAAAGAAATAGGAAAAAGGGAATAAAGAATAATAGGCCCCACAAAGACA
TAAACAGCAGTCCTGACTGGGGCAATGCCCACAGAGGAACCGATTGGCAGAGCGAAAAAG
CAAACGGCATGAACAGGGCCAAGAACTCTCGGAATTTTACCACTAATATTAAATTGCAGC
GACAACATTTTGGCGAAGAAATACAAGGTGGCAGCCAGCTTGTGATATCTACAAATTCAG
ATGCTTCAGATAAATTGTTAATGCTATTCAACCTAACTTTGGGAGTAAACCAAGAAAACT
TGAAAAATGTTCTGGAAAACATTTCTCAGGTGCAGATAGCTCAAATTAGGGTTAGAGACC
TGCCTTCAGGATCTGCCACCGCTAAGGTCCGTCTGGCATATCCTACAACACAGTCTTTGG
AGAAGGTAAGAAAACTGTTCCATGGCGCTCTAGTTGATGGAAGGCGCATCCAAGTGGTGA
TTGCATCTGATGAATCGTCCCACTTGTCGTATTAGAGTTTGTCAACGACACTCACAAGGT
ATTTAATCAGCAAAATCCCCGCCACAAACTATTTTTTTGAAGACATGCTTTCTCATGACT
GCCTAATAACAATACCTCATTCTACTAGTAATCGACCTATGTAATTATTTCATAAACTAT
AAAGCAGGTCATTGCAATAACAGAAAGGCCGGTTTTTCTATAAGCTTATCTCATCGCATA
AAAAATCGACAGTTGTAATTATCTCCGGCGGACTTTTCCCTTTCCGTCTTTTTTTTCAAA
ATTTTTTTTTTTTTCACTTCTTCTTTCAAAGCTGCCTCAAAAGAGATATATATATTGGTA
AGAATCCTCTTCCAATACTAGCTTCATTTCTTCTTGAACC
Chromosomal Coordinates Chr VIII from 362115-362765
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator