Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TRR2
Systematic Name YHR106W
Description Mitochondrial thioredoxin reductase involved in protection against oxidative stress, required with Glr1p to maintain the redox state of Trx3p; contains active-site motif (CAVC) present in prokaryotic orthologs; binds NADPH and FAD
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TRR2	6321898 upstream sequence, from -1000 to -1, size 1000
CAGAACCCAACGGTAATTGAAATTAAAAGGGAAACGAGTGGGGGCGATGAGTGAGTGATA
CTAAAATAGACACCAAGAGAGCAAAGCGGTCCCAAAATCATTTGAGTAACCGGATATCTA
TCGGGATATTAATAGCAGCTTCCATTTCAACTAAAACAACAGCAAGATATGAGCGACAAG
ATATCCTTTCTACCTCCCGAACCCATCCAACTACTTGACGAAGACTCCACGGAGCCTGAA
CTCGACATTGACTCACAACAAGAAAATGAGGGACCCATCAGTGCGTCAAACAGCAATGAT
AGCACTAGCCATAGTAATGATTGCGGTGCCACAATTACCAGAACAAGACCTAGACGAAGC
AGTTCTATCAATGCAAACTTTAGTTTTCAAAAGGCTCATGTCAGCGATTGCACCATAGTC
AATGGCGACCATGGAACAAAGTTTGCTGTCTGGAGAATTACCGTATTTCTTGAACCCAAC
TTGAAGGCTTTTGCGGCCAAGAGGGAAAGCTATAAAATCCAAACCTATAAACGATACTCC
GATTTCGTCAGATTACGAGAGAATTTGCTCACAAGAATCAAGACAGCGAAACCTGAGAAA
CTTAACTGTTTGCAGATTCCACACCTTCCCCCTTCAGTGCAGTGGTACAGTTCTTGGAAA
TATCAAGAAGTGAATCTGAACAAGGACTGGCTGGCAAAAAGACAGAGAGGGCTCGAGTAC
TTCCTCAATCACATCATCCTTAACAGCAGCCTCGTAGAAATGACCAAAGATATACTCATA
CAGTTTCTAGAGCCTTCAAAACGAGTTGCATAGCTCACCATCCCTATCCAACCGACTATT
CTTCTCATCGACTACTACTATCCCATTTAACTCGGGCGCGTTGTTAATTAATCACTCGAT
GGGGAATGCCTTGAGCTGACCGCAATGAAAACTTTTAGGGGATCGTCCAACATTAAAGGA
AGAACGAAACGGACTCCACAGTTTCTAATATAAATAAACA
Chromosomal Coordinates Chr VIII from 325598-326626
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator