Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SFB3
Systematic Name YHR098C
Alias LST1
Description Component of the Sec23p-Sfb3p heterodimer of the COPII vesicle coat, required for cargo selection during vesicle formation in ER to Golgi transport; homologous to Sec24p and Sfb2p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SFB3	6321890 upstream sequence, from -1000 to -1, size 1000
CTGGTTTAGAAGTAAAGGTATCACAGCTTGTAAGAAAAAATGGTAATCCTCAGGAGAATT
CAGTAATTCCATTATGTCGTACAATTCCGATAGAGTGGAATATCTCGATTGTAGAGTGGC
ATCATCATCGCGAAACCTACTGGCGAATTGCTCGATCTGCTCAGTGAGTGACATCGGCAA
AATGCGGTATTCTTTGTAACTATGGAGATATCGTGTGATAGATCTTCTCTGAATTTAATC
TTCTTTATGTAATTACGTGTGATACCTCCGATTTTGTTGGTGTTGTTTATTAGAATACAA
CTAAAAAAGGCTATTAAAGAAAAATGGTTCTTGAGCTTTTTTTTCAGTTTGACCTGGAAA
ACTGTCTGACCACGTGATCACTTACCAAATTAGGAAACACAAGATTCAAGGTGGTCTTTT
GAACAATTGTTGGTTGAATTTGTAATTTGAGGGTACAATAAATGCAGACTGATTTGGTAT
TCGATACGTGCGTTAGCTATTTTCGTGCGTTTTGTTTGTTCCTATGATCTCAGCGGCGTC
CAGATGCTAGTTGAAAAGGCATGAATTATGGCTTTGTCTTGAAATGCGCGTGTCCGTAAA
ATATTGTCTGGCAGAGTAGCGTACAATTCTTAGTTTTGGCTTTTTGATTCAAGTTGATCT
TCAAATTTCACTTATTTGCGTTCTGGCGATCTATCTGAAGGAGTTGATTAGTGGCGGCTA
AAAGTGATGCAGCTCGTCCTTCTGTTTGCCCTATTGAAGGTGAAGCCTTCCGTGCACAAT
GCGAAAAAAATGTTCTTTTTTTTCCTTCGTTTCGTCTCAACGTGGGAACGATCAAACTGG
AAAAACCAAAGAGAAAAATGTTAGAAAATAAATAAATAAAAAAAACACGTACGCTGTAAC
AACTTAGGTCTGATTCAACCAAATCGGAGCTTGCAACTGAAGAAATTAGTAATTTTGAGG
GTTACTAAGGAGGCCATTTGCAGAAGAATATTGGACCATC
Chromosomal Coordinates Chr VIII from 301934-299145
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator