Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HXT1
Systematic Name YHR094C
Alias HOR4
Description Low-affinity glucose transporter of the major facilitator superfamily, expression is induced by Hxk2p in the presence of glucose and repressed by Rgt1p when glucose is limiting
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HXT1	6321886 upstream sequence, from -1000 to -1, size 1000
GGCCACAATGAAACTTCAATTCATATCGACCGACTATTTTTCTCCGAACCAAAAAAATAG
CAGGGCGAGATTGGAGCTGCGGAAAAAAGAGGAAAAAATTTTTTCGTAGTTTTCTTGTGC
AAATTAGGGTGTAAGGTTTCTAGGGCTTATTGGTTCAAGCAGAAGAGACAACAATTGTAG
GTCCTAAATTCAAGGCGGATGTAAGGAGTATTGGTTTCGAAAGTTTTTCCGAAGCGGCAT
GGCAGGGACTACTTCGCATGCGCTCGGATTATCTTCATTTTTGCTTGCAAAAACGTAGAA
TCATGGTAAATTACATGAAGAATTCTCTTTTTTTTTTTTTTTTTTTTTTTTTTACCTCTA
AAGAGTGTTGACCAACTGAAAAAACCCTTCTTCAAGAGAGTTAAACTAAGACTAACCATC
ATAACTTCCAAGGAATTAATCGATATCTTGCACTCCTGATTTTTCTTCAAAGAGACAGCG
CAAAGGATTATGACACTGTTGCATTGAGTCAAAAGTTTTTCCGAAGTGACCCAGTGCTCT
TTTTTTTTTTCCGTGAAGGACTGACAAATATGCGCACAAGATCCAATACGTAATGGAAAT
TCGGAAAAACTAGGAAGAAATGCTGCAGGGCATTGCCGTGCCGATCTTTTGTCTTTCAGA
TATATGAGAAAAAGAATATTCATCAAGTGCTGATAGAAGAATACCACTCATATGACGTGG
GCAGAAGACAGCAAACGTAAACATGAGCTGCTGCGACATTTGATGGCTTTTATCCGACAA
GCCAGGAAACTCCACCATTATCTAATGTAGCAAAATATTTCTTAACACCCGAAGTTGCGT
GTCCCCCTCACGTTTTTAATCATTTGAATTAGTATATTGAAATTATATATAAAGGCAACA
ATGTCCCCATAATCAATTCCATCTGGGGTCTCATGTTCTTTCCCCACCTTAAAATCTATA
AAGATATCATAATCGTCAACTAGTTGATATACGTAAAATC
Chromosomal Coordinates Chr VIII from 292625-290913
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator