Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NMD2
Systematic Name YHR077C
Alias IFS1, SUA1, SUP111, UPF2
Description Protein involved in the nonsense-mediated mRNA decay (NMD) pathway; interacts with Nam7p and Upf3p; involved in telomere maintenance
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NMD2	6579193 upstream sequence, from -1000 to -1, size 1000
TGAAGGATAGCATGATTGCAGTCAGAGGCCACACCCAAGTCGTTATGAAAGTAACTTCCT
TGTCCATTCCAGCAACCTTAATCTGCCATAGAATAATCTCTATGGTTACTGTATACGTCA
TCATTGCTAATGAAAAAAGGACTCGCAGTGATTGCAGTACCTTATGTGAGGGTAAAGAAT
ACTCTGTGTAGAATTTATTTATGAAATTACCCATACTAGACACATCCTCATTCGAGCCAA
CTTCCATTTTGCTTGCCAACGGAATGACATTTTTCTTCGAGGAAGTTGATATAATGTCAA
ACAAAGACCCTACTTTAAACCAGAGCCTTTCATAGGAGCATTTGTAAGCAAATGCTCCGG
ATACGGAAAGCACTATAAATACGATAAGTGCCTCCATCCCGTCCACCACTTAGTCTACAC
TCAATAGTCCTTTCTAGTGCAGGTCCTGGAGGCAACCGCCAGAGTTGAGATCTTTTCCTT
TTCTTTCCCTGCTGGTCAATTTTTATTGTTCAGGACTCGGTCATCGCAGATATCGCAATT
TTTCACTCGTTTGAGTCTAGACTGTAAAATAAAACCGAATGGTTAAGCTAAAATAGACTC
TGTATGACTAAGTCGTTCACTAAAGTTCATTATTTCATGCCTGAATGACCTTTATCTTAA
TTATGCACCATCATATAGCGTTTCTATGATCACTACGGGATATTATGATATTGTTAGGGG
GTTATATTGAATATTTCTTAGGGCATGAGGATGATATTAGGGTTATTAATAGGTTTACAA
TTATATAATTTATGTGATAATTATCACTTGATACGAATTGATGGAGCCTGCTTCTTTTTT
TTTTTTTCACTTTCTTGGCAGTCACTGAAAAACTGCATTCGAATACAGGTTTGAGAAACT
AATGAGGCCCATATTACTTTACAATGAACAGTAACAATCAACTTAAATGCTTAAATAATC
TAATATTGTATCTGCATTGATAATACATTGGACAGAAATT
Chromosomal Coordinates Chr VIII from 255637-252374,255756-255751
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator