Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name COX6
Systematic Name YHR051W
Description Subunit VI of cytochrome c oxidase, which is the terminal member of the mitochondrial inner membrane electron transport chain; expression is regulated by oxygen levels
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COX6	6321842 upstream sequence, from -1000 to -1, size 1000
ACAACTTACTCTGTAGTACTCTTTCCAAGGGAGCGGGAACGGTATTCGTGCTGGCATTGT
TGTTTTCAGGACAGAGTGCCGGTATCGTGTGTACGTTGAGTGGACAAATGGTTAGTGAAG
GGTTCTTAAATTGGACTGTTTCTCCGGCATTGAGAAGATCCGCCACAAGAGCGGTAGCCA
TCACGCCTTGTTTGATTTTAGTGCTTGTAGCTGGACGTAGCGGCCTCTCTGGTGCACTAA
ATGCTTCCCAAGTGGTACTTTCTCTCTTGCTGCCTTTTGTTTCTGCACCTTTACTTTACT
TCACTTCAAGCAAGAAGATTATGCGTGTACAGCTTAACCGTACCAAAGAACTTTCAAGAA
CTACAGACAAAAAACCCGTGGCCGACCGAACCGAAGATGATGAGACCATTGAGCTCGAAG
AAATGGGCATAGGCAGCAGCTCACAGGAGCGCAGCTTAGTTTCTCCTGCTCCAGAATACA
AAGACATGAGCAATGGAATGATCGTCACCGTGCTCGCAATCATAGTATGGTTGATTATCT
CCGGACTGAACTTTTATATGTTACTGGGCTTTACTACGGGCAAAGAAGTACACCTCTAAT
ATAACAATTCTTTAGACTAGTATAAGTATACATTTTATCCAAGAATAATAACAGAAAATT
CCAATCAAAAAGTTGGTGTTAGGCTATACTGATGGCCGTATCGCTCCATACGAGCCAATC
AGGGCCCCGCGCGTTATTTCCGCCGCTTACAGCTTTCTTTGAATCTCCCTATGAAAAGGG
ACCTAATTGGTCCGGTCAAAGCATTAATAAAGATCAACAATTGCTCTTGCTTATCAAGGT
GCCAGATCTCAAGGTTACCTCATTTCTTTACATTTCATCCACATTTTAGCACACTTATTT
ATTATTACAATTTGAAAAATTGTATCACTTCTGAGACTTAGTAGCGGAGATAAACAGCCG
AACAATTGTATTTGACACATAAACTAATAAATATACAACA
Chromosomal Coordinates Chr VIII from 209705-210151
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator