Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ARD1
Systematic Name YHR013C
Alias NAA10
Description Subunit of N-terminal acetyltransferase NatA (Nat1p, Ard1p, Nat5p); acetylates many proteins and thus affects telomeric silencing, cell cycle, heat-shock resistance, mating, and sporulation; human Ard1p levels are elevated in cancer cells
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARD1	6321801 upstream sequence, from -1000 to -1, size 1000
GAAGTAGATTTTGGAGGCTGCTCAATGTCCTCGAACCTTAAGGAATTATCAAATGAGGGG
CGCTCTATTGTTTGTCTTTCGTTTTTCAAGGTATTGCTTGATTTATTTTTCAAATATCGA
ACATCTCCAGCCTTTGAGTACTGTTGAGCATCACTTACAAAATTTAATCCTGGATGTGGG
CTTTCTAGTCTTAAATCGACATGTTTCGAATTGAATATATTTTCTGATTCTGTTTTTTTT
GTTTTTCTGATTTCCTTATTCTTGATTTCTTTACCAATTTTAAAAGCAAGTGGAGAAACT
CGCAAGTTTGGGGTCTTCTCTTGAAGAGGTTTTTGAACTTTCCTTTTAGAATGTGTTGGT
GACCCTAATTCGAGTAGCCTAAAGCGTTTTCTGGGTGCCATAATTATTCTCGACTCAACT
TCAATCCGTTTTCTTTCTTCTTATTGCGCTAATTGTCTGTTAGACACTTTTATGAGACTT
CCTTTTTGTCGGCGGCTATTTCTCAATATACTCCTAATTAATACATTTCCGTGCAAAGGT
ACTAACTAGCTAAACGGATACTAAAGAATTCAAATGTGAATTTAAGCATAACTGCAGGTA
AATCAAGAAGCTTGAATATTATACTGTAGTCAAAAATTAGATGTGTAAATACTGTGTATT
ATAATTCTGAAGTTTATTCAGAAAATATCATGGAACAAATGATACGCTGAAGTGCCTTCT
GCCCGGAGATAAAGAATTCATAAAGTATAATCTCCATGAGACTTCCAGGACAAATATTTT
CTCTTAAAGCGCTTGCTTTAGTAGTATTGCATCCAATGCTAATTTGTCTTTATTGATCTC
TAGGCTCAATCCTCACTTTCTCGCGTCAATTGGTTTTTTGAACAGAAAAAAAAAGCACCG
TCTGAAAAGTTTGAAACCTTTTGTCAGCAACGAGTAATTGCCAAGTGAAAAGGGAAACCT
AAATACATACGATCAAGCTCCAAAATAAACTTCGTCAACC
Chromosomal Coordinates Chr VIII from 131446-130730
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator