Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GUT1
Systematic Name YHL032C
Description Glycerol kinase, converts glycerol to glycerol-3-phosphate; glucose repression of expression is mediated by Adr1p and Ino2p-Ino4p; derepression of expression on non-fermentable carbon sources is mediated by Opi1p and Rsf1p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GUT1	6321755 upstream sequence, from -1000 to -1, size 1000
TCCAGACAAGCAACCACACCACATGAGCTCACAACCGTCTTTCGTCACCATAAGGGGCAA
GGCCATTTCTCTAGAAACACAAACGGAGTCACTTCTTTCCAAGTACTCCACATTCGCGCA
GACAACTAGTTCAGAACAAACTGGCCAAGAAAAGAAGATAGACAAGCAGTTGGAGGGAAT
CTTAGGCCAGAGACAGGATGTAATCGATTCATTAACACAAATCTGCGATTCTAACCCGGC
AATCTCCGCCTCAAAGCTTTCCCAACTGCACCGCCACAAGGAGATCTTACAAGACCACTG
GAAGAGCTTCCGCAATATCAGGTCCTCCATCCAGCAAGAGCGCAACAGACTAAACTTGTT
ATTCAGCGTGAAGAACGATATTGCTAATTCCACAACGGACGCGCCAGCTCCTATAGGGGA
TGCTGACGAGTACATTCAGAACGAAACAAGGCGAATCGATCAGTCCAACAACGTAGTCGA
CCGTCTCATCTCCCAAGCCTGGGAGACTCGGTCGCAGTTCCACTCGCAGAGCAACGTGCT
GAACACGGCAAACAACAAGGTGTTGCAAACTTTACAAAGAATACCAGGTGTCAATCAGCT
TATTATGAAGATTAACACGAGAAGGAAGAAAAACGCGTTTGTATTGGCCACGATAACCAC
CCTTTGTATACTGTTTTTGTTTTTCACATGGTAAATAACGACTTTTATTAAACAACGTAT
GTAAAAACATAACAAGAATCTACCCATACAGGCCATTTCGTAATTCTTCTCTTCTAATTG
GAGTAAAACCATCAATTAAAGGGTGTGGAGTAGCATAGTGAGGGGCTGACTGCATTGACA
AAAAAATTGAAAAAAAAAAAAGGAAAAGGAAAGGAAAAAAAGACAGCCAAGACTTTTAGA
ACGGATAAGGTGTAATAAAATGTGGGGGGATGCCTGTTCTCGAACCATATAAAATATACC
ATGTGGTTTGAGTTGTGGCCGGAACTATACAAATAGTTAT
Chromosomal Coordinates Chr VIII from 38508-36379
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator