Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BGL2
Systematic Name YGR282C
Description Endo-beta-1,3-glucanase, major protein of the cell wall, involved in cell wall maintenance
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BGL2	6321721 upstream sequence, from -1000 to -1, size 1000
CACTATTACAATATTTTGTAACGCCTCCAAACTTACTGGATACTACATTCAAAAAAAAAA
ACAAGTTATATTTAAAGTGTGCATCTACCTTTCCGCCATTGAACCAGCTACCTTTTATGA
ACGCATCTGCCGAACAACACTACAAGGAAGGCTTATCAATCGCACGAGATAGCTCAAAAG
GTAAATCTGATGATGCTCTAACAAATTTGGTGTATATAGGAAAGAATCAAATTATTACGT
TATCTAACCAAAATATTCCCAATACTGCGCGTGTAACAGTTGATACAGAGCGCAAAGAAG
TAGTGTCACCCATAGATGCTTACAAAGGAAAACCACTCGGCTATCATGTTCGAATGGCAA
GCACTTTGAATGAGGTGTCCGAAGGTTACACAAAGATCGTTTGGGTCAACAGTGGTGACT
TCCACTACGACGAAGAGTTGTCAAAGTACCACAAGGTAGAAACAAAGCTACCATACATCG
CAAAACTGAAAAAAAGTTCAACATCAGAAAAACCCTGTAATATCCTGCTTATCTTCGGGA
AATGGGGCCATTTAAAACGTTGTTTCAGGAGATCTGACTTAGAATCCTCTTCTTTGCATC
ATTACTTTTCTGGTCAACTGCAATTCCCTGCTTCCGTACCCCAGGGAAATATACCCATTC
AAGATAGCCTACCCATAGCTCTTACCATGTTTCAGCGTTGGGCAAGTTGAAATAAATAGC
AATTAATAACTGATATTACTATTTATGTTATATAATCATCGTTTTCTACGGATATGCAGT
TCTATTTTTAGTAAAAGAAACGTTAAAATTTTTCTTTCAGTTTTTCGCCCTGAAAAAGAG
AAAAATGTCACGAAGAAAACAAGAGGATATTTGTTTATTTTGATTTTAACTGCCTCCTTA
TAAAGAAACTTTTCCTCATTCACAATTTGGACTTCTTCTTGTTTTTTTCAATATAAGTTT
ATTGAGATAGACAACTAACCAAAAAGAAAAACGGTCAAAG
Chromosomal Coordinates Chr VII from 1058724-1057783
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator