Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SOL4
Systematic Name YGR248W
Description 6-phosphogluconolactonase with similarity to Sol3p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGR248W	6321687 upstream sequence, from -1000 to -1, size 1000
ATAGCATTATGGTATTGTCCACCACAAGGATCAGTTGCTTACGAGACATTACAGATGCTT
ATATTTTCGTTTCAAACGTTGTTCCCAGATTCACCAGTTTTTGAACCTCATGTGACGGTA
ACGTCCCATTTGGTGTGCAATAGTAAAGATGATGTCAACAAAATCTTGACCTCCTGTGTT
GCTGCCATCCAATCGATAAGGTCACACCAAACAGCAAAGAAAGGACGTAAGGGACAGGTA
TCCCATGCTGTTGCAGCTCCTTTGGTATCTTTCAATGGATGCAGTGTAGGTAAACAATAT
TTCAAGAAAATTGTGCTCGAGTGTAACAAGAACAAAATACTTTATGGGGTCGCACAAGTC
ATGAGAGAGATGTACGTAGAGATCGATCCTGAGACGCGAAGTAGCCGTGCCGCCACTTGG
GTGCACGAGGAATTCCATCCTCACGTCTCATTGCTTTATTCGGATATTCATCCGGTAAGT
CAGGCGTCATTGCGAGTAGTTCAACAAAGAATTGAAGATGCTCTAGACGTGCAACTAGTT
CCAAGAGAGAAACGTAAGGGTTCCGGAAACGCTGATGGGTCCAATGAAGTGCAAATGAGA
TGGGATTTTGACGTATCTTCATCGCTATCTTGGAATATCCCAGGAACGTTTAAAGTGGTC
AACTGTGTGGGGCCCGTTCAAGAATGGGAGGTATTGGGACGGGTGGACGTTTAAGCATAC
ATTTATGTGCACTGTAAGTAATTATATAGAATTTTTTTTTTTTTTTTTTTTTTCATATCT
GTCAATACTTGAAAATGTTCTAGTTAGAGATTTACGTATACTGATCGCTTGCCTTCGCAA
GGGATGGAAATCCCTTGAAAATTAAAAAAATCCCCCCCTAAGCAGCGAAAATTGTAAGAT
CCATAATATTTAAGAAATGACGAAGAACGTAGTCTTATCGCAGCAGTTTTCCAAACAAAG
AATGCCATTCATCAAATAATCCACAACCACCTCAAGAAAA
Chromosomal Coordinates Chr VII from 985972-986739
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator