Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BRF1
Systematic Name YGR246C
Alias PCF4, TDS4
Description TFIIIB B-related factor, one of three subunits of RNA polymerase III transcription initiation factor TFIIIB, binds TFIIIC and TBP and recruits RNA pol III to promoters, amino-terminal half is homologous to TFIIB
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BRF1	6321685 upstream sequence, from -1000 to -1, size 1000
AATATTGTTTACCTACACTGCATCCATTGAAAGATACCAAAGGAGCTGCAACAGCATGGG
ATACCTGTCCCTTACGTCCTTTCTTTGCTGTTTGGTGTGACCTTATCGATTGGATGGCAG
CAACACAGGAGGTCAAGATTTTGTTGACATCATCTTTACTATTGCACACCAAATGGGACG
TTACCGTCACATGAGGTTCAAAAACTGGTGAATCTGGGAACAACGTTTGAAACGAAAATA
TAAGCATCTGTAATGTCTCGTAAGCAACTGATCCTTGTGGTGGACAATACCATAATGCTA
TTGCCATTTTTCTGTGGTTACTGATATTAGCAAATTGAAGTATCGCGAATTCCCAAACTA
GAATAATTACAATTGATGGTAAAATAAAATGATAAAATAATCTGATTAGATTCTTGGTAT
CTCAAAAGTGACTTTGATAACTTCTTGATTGTTTGTGCCCCTGCTTACGAATTGGGTTCT
TATTAAACTTCACCTGCATCGCTTCTCCATCGGATCTAACCTAAAAAAAATAAAAACCCC
CCGGTAAGCACTTGATCACGCCTACAAAATCACTTAGTGAACAAAGGAAAATAGATTGTT
TTTAAAGTTGTGAAGTAGTGAACTATGGCTTCCCACATACACATATATACTGATACAGAT
GCAATATAACATTTAGTGTTAGAAAAATTTGCTTCTATCTTGATGACATTGAATACTCTT
GGACGTAAAAAAAGACATCCGATTAAAGTGGAGGTAATCTACAAGAAAAGTTGTTCTTCC
CCTCATTAGAAATCTTGCAATGGTCACGGCCGTCGCTATCAAAAATCAACGAAGTGAAGT
GACTCTAATTTTTGTCTATTAATGTTGCGATGGCCTTATTTGCTATTCTAAGGTTTTCGC
GAAGTATCAGGTATGATAAAAAAAATCATATTTTTGATCGCATCAAGAACAATCCCAATG
GTAAAAACGGTAATAAAAAAGAGTCCATAGTCATATACCA
Chromosomal Coordinates Chr VII from 984272-982482
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator