Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PEX21
Systematic Name YGR239C
Description Peroxin required for targeting of peroxisomal matrix proteins containing PTS2; interacts with Pex7p; partially redundant with Pex18p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX21	6321678 upstream sequence, from -1000 to -1, size 1000
TTCTCCAAACACTGACGCTAAGGTTTTGAGATTCAAGTTCGATACTCACGGTGAAAAGGT
ACCAACTGTTGAGCACGAAGATGACTCTGCTGCTGTTATCTGTGTTAATGGTTCTCACGT
TTCCTTCAAGCCAATTGCTAACCTTTGGGAAAACGAAACCAACGTTGAATTAAGAAAGGG
TTTTGAAGTTCACTGGGCTGAATACAACAAGATTGGTGACATCCTGTCCGGTAGATTAAA
GTTGAGAGCTGAGGTAGCCGCTTTAGCCGCTGAAAACAAATGAATGATTGCAATGAAAAG
TTTAAGTTAAGCAAAAGGAGGTAAAAATGGCATGCACTTTAATTTTTATACAATCGTTTT
TTTGTCATAAGACTTATTTATGTATCTGTTGTTTTTCTTTTTCTATCCTCTATTTTTGTC
TATTTGTCTTTGTTTTACTCTTTTTCATTATTATTTCTTTATATAATTTTTGTACGATAT
GATACACATAACAATGAGCAATGAACATATTTCTAATCCTAACCATTAGATATACTTTTC
AACTGAGGAATAATGGCGCCTTGATTAAACTAAGCTATGGAATTTGCATTATTCAAGTTT
TAGGGTGTGCTTAATCTGCGTTGACAATGGTTCACGAAGACGACATCGGCAACTTTGCTG
TACTACAAATTGCTCTGAATGTGAGGCTGATCCACATCATAGTGAGGCGCGCTACCTTAA
TTGTAGTCGTATTGTCATCGGTCTACGAATACCGTTTGGTTTATTTGTCGGCCTTTTTTC
TTTCCGTTTCTTTTTATCTTTCCGCTGGAAAAATGGAAACTAGTGCCGATAATCGGAGAT
GGGATGACTAAATATTTCTTTAAGGCATTGGCAATGTTCAAACCTCTGATAGAACGGCAG
ATATATATTTAAGAGAATATAGTCAAGGTTGACGCCGCATACTTTGGTTTTGTTTCAAAA
AGAAACAGGTGAAAAATTATAAAGACCAAACTAGAATACC
Chromosomal Coordinates Chr VII from 970053-969187
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator