Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name AMA1
Systematic Name YGR225W
Alias SPO70
Description Activator of meiotic anaphase promoting complex (APC/C); Cdc20p family member; required for initiation of spore wall assembly; required for Clb1p degradation during meiosis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AMA1	6681847 upstream sequence, from -1000 to -1, size 1000
TTATTTCAAGCATTTTTGGTGTTGTTGGTGCGGGTATATTAACCCTATTGAACAATAATG
CCAATAACTCTGCTCACATCGGCCTTTTGATATTACCTGGCGTTGCTTTCGGTGGTTTGG
CACAAAGTTCCATGCTCGCTTCTCAAATTCAGTTAGACAAGAAGAGCCCAACTTTTCGAT
CAGATTTTGTCTCTATTACCACTTTTAACACATTTTGCAAAAATCTAGGTCAAGCACTGG
GAGGTGTCATCTCTAACACTGTTTTCAGTGCTGCTGCTATCAAGAAATTAACCAAGGCTA
ATATTCAGCTCCCAGATGGTACCACGGTAGACAATCTGGTAATCTATAGGCAGACCAATT
TCGATGGCTCTCATTCCAAATTGGGCAATATAATTTCTGAATCTCTCACTGACGTCTTTT
ACATGGCATTAGGATTTTATGCATTATCTCTCATTTTTGCTGTTTTTGCTTCAAATAAGA
AAGTCACAGCAAGCCTGAGATAAGTTAAGCACGATTTAGAAGGTGGCGAGCCTCAAAGTG
TAAAGCTGCAGAAAAAATAAACATGACTTTTAGTAATTGGCTGTTTAGCTTGCTGAATTG
TGTACCACAACTAACGATAACAGTAAGAGGGTAATCCGAGACAGTATGAGTACAGCTATT
AAATAGTTAATTTAGATTTTTATACTGGTATGATAAACGACGTTCATATAGCAAGAGCGT
CAATGCCTCTATGTCACCTTCAATAGAAGTTTCCCTTTTTATTTCGACTTTTGTTTTTGT
ATTTTTCGGCGTCTGCCTTGTTCCATTTTTAAGGCGCCAAAAATAAAATAAAATGATGAA
CGATTAGTACTCAAAGAACACTTTAATCCTTGGAAACAAAAAAATAAAAAATCAAAAGTT
GAAGGAAGGTCAAATTTTCTTCCTCCAACGATAATAATACTTGCTTATATAACTCTTTTA
AAGTTTTACAAAACTTTGGATCAGAAAAAAAGAAAAAAAT
Chromosomal Coordinates Chr VII from 945145-946327,946421-947019
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator