Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ELP2
Systematic Name YGR200C
Alias KTI3, TOT2
Description Subunit of Elongator complex, which is required for modification of wobble nucleosides in tRNA; target of Kluyveromyces lactis zymocin
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ELP2	6321639 upstream sequence, from -1000 to -1, size 1000
AGATGTAGCAGTGCGAAGCGAACTCGATACTTGCTCATCATTGATTTCGGCATCTTTGTG
TAGAAAACTACAAATGTCTGACGGAACACTGTTTACTGATTTGAAGGAGAGAAAGTTGAT
TAGGACCATTGTGCCAAGAGGTTTAGTGCGTTCCTTGAAGCTGGACGTTAAGCTTGCTGA
TCCAAGTGACGCTCAGCAACTTTACGAAAGGGAGTTTCCCTTGCGTAAGTACCCAACTTT
TGTTGGACCGCATGACGAGTGGACGCTTACAGAGGCAATGGCTATTGACTACTACTTGAT
CCATCTGTCGAGCGACAAGGAAGCTGTGCGCCAGTTGTTGGGTCCCGAAGGTGACTTCAA
AACTCGTGCAGATATTTTAAGATGGGAATCGCTTTCCAACAGTGATTTCTTGAATGAGGT
TTGTGAGGTGTTTTTCCCTCTAATTGGCGTAAAGCCATATAATGCCACTGAATTCAAAGC
CGCAAGAGAGAATGTCGACACCATTGTTTCGCTTTACGAGAAAAGGTTAAAGAAACAGCA
ATACCTTGTCTGTGATGACCACGAAACTCTTGCTGATTTAATCTCAGCGGCTGCTTTTTC
GCTAGGGTTTATAAGTTTTTTCGATGAAACATGGAGGTCTAAGCATCCAGAGGTTACGCG
CTGGTTTAATCGAGTAATTAAGTCCCGCTTTTTTGAAGGTGAATTTGAGAGTTTCAAAAT
GTGTGAGACTGAGATGCAACCCATTAAATAAGAGTATAGTGTATAAAGATCAGTATAATT
TATAGCCTGGGTCGGTCCTTTAAGCGATTTCTTCTTATTAACCTTGTCAGCCGTTTCCAC
GTGACGGGAAAAGTGTCCGATATTGAAATAGATGAAAAATTTTTTTGTTTTAATATTAGG
CGATGGGCAGAGGTAGCTTACAATTGCACGTAGAGACTAGTATATCTATTTGTATATCCC
AGTTCCTGCAAAAACTTTATATAGTTAACGTTCCATAATC
Chromosomal Coordinates Chr VII from 902270-899904
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator