Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NOP7
Systematic Name YGR103W
Alias YPH1
Description Nucleolar protein involved in rRNA processing and 60S ribosomal subunit biogenesis; constituent of several different pre-ribosomal particles; required for exit from G0 and the initiation of cell proliferation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NOP7	6321540 upstream sequence, from -1000 to -1, size 1000
GACACATTCTCATTCGAAATATTGTAAATACTGCTATGTCTTCTATGTACTTAATCTTAT
TTATGCATTTGAAAAATATTTCAGCCTTATCGTGGTGGTACATGTACAAGAAAATTCATA
GGCAAAAGAATATATAGAATAGAGCGTATGTGTTACTTTTCTAAGTCTTACTTCCTGTTT
TTGAGTAGTCCCTCTTTGACAACAAAATATGCATTTTTGGATTCCGCGGCAAGTCCAGTT
GCTTTCCAAGATCCGCTAACTTCTCCTAGCTCAGCATCCTGCTTTTGGTGGCTGATGCCT
TCAAGTAGCTTTGTGTAGTTCAGCTGTTTCGTATTTCTTTGCACCAACCGAGCATCATAT
TCCTTGGTGTGCTTTTCACCTTCGACAGGTATGTTATGGAGTTTGTTGATGAATGATAAT
TGCTTGGCAAGTCGCATTTGAATTTCTTTAATATCTGCTCCTTCCAAGGGAAGACCTGAT
AACCGCAACAATTTTTTTACAGCTTCAGCAGACGGTGGCTCTAGTTTTTCCTCTTTAGTG
TTTATGCCTAAATATTCGTGGACGGACCATACAGGTCTTGATAAATAATCCCTTATTTGA
TTCATATTTTCAAATTTTTTACCAATCTTTGCCCCTCCCGTAGATACGAACCGATGACTT
CCATCATGGCATAACCCACCCACTGTATGTGTTCTGCATAGACGCCATGTTTTGTACATC
GTTCTAGCACTATGGGTAAGTGCAAATAGTTCGATCTAAAAGCCTAAATGCTAGTCACTA
TTACCTCCTTGATGTTATATTTACAGAATAATGTCATGTCGTCTGTGGTGACTATTATTA
TTGCCTGAAAAAATTAAAGAAAATTTTTTGCGATGAGATGAGATGAGAAAAAATGAAAAA
TTTTGGAAGGTTAATTAGAGATGTGTAGTAAATCCTGCTGGTGGAATACATTTTATTCCT
GTAGAAAATAGTATAGTAACAGCGGTATCCTACTTATACA
Chromosomal Coordinates Chr VII from 695421-697238
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator