Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL11b
Systematic Name YGR085C
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl11Ap; involved in ribosomal assembly; depletion causes degradation of proteins and RNA of the 60S subunit; has similarity to E. coli L5 and rat L11
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL11B	6321522 upstream sequence, from -1000 to -1, size 1000
CAGGCCTGCTTACGATGGGTATGAAGCCTCTAAACAAATCATTATTGATGCTGAAAGCGC
ACTGAATGAATGGACACTAGACTCTGCCCAAGTCAAGCCTACTTTAAGTTTCAAGCAGGA
TTACGAAGACTTCGAACCTGAAGAAGGCGAAGAAGAGGAAGAGGAAGACGGTCAAGGCAG
GTGGTCCGAAGACGAACAAGAAGATGGACAAATTGAAGAACCTGAACAAGAAGAAGAAGG
TGCTGTTGAAGAACATGAACAAGTCGGACACCAGCAAAGTGAGTCTCTTCCCCAACAAAC
AACAGCTTAATCAAAATAAATCAACAATCTATTAGAAACAAAAAAAAAAAAACCAGCAGA
AAAGAACAAGTTACCATACTAATTAATCTCTTTTAATTAATGCGTGGACAGATAATCATT
TCTGTTCCCTCACTCTGAAAAAATTGTTTTATTTTCCTATTTTTTTTTTCATCTATTATT
GTATTTTGCCCTCTCCTCACTCCTTACTTTAGTCTATTATCAATATCTCTTCCCCCTCCT
AAATATGTACTCTTTTATTTTTTTTAATTGTGAAGGAACAATTCAAGTTAGAACTCTTTT
GATAGGAAACATTATTTCCTGTGTAGCCTAATGTTTAATGCCTAATTTTTTTCTAAAATG
CAGCAACATACATATGTTGAGTCGTATAGACATCTATATATAACAAGCACAGAACCGTCT
AATTGGTATTTTTCAGGACATTTTAAACATCCGTACAACGAGAACCCATACATTACTTTT
TTTAATATTCTTTTTGTTTTCACCGCCTTCTTTTTATTTTTATCCGAAGATCTTTTGGAA
CCCGCTCTGCGAATAGCGAAGCTAGGATACCAAATTGAAACTTGGACATAACTCATCATT
AAAGAAGTATACTGTTAAGAGAGGCATTCATTTCGTGTATTATAACGTTTAGCATCAGTT
ACCCTTGAAAGCCCAACATATACAAAAATACGCGTCCAAG
Chromosomal Coordinates Chr VII from 648907-648383
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator