Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ERG25
Systematic Name YGR060W
Description C-4 methyl sterol oxidase, catalyzes the first of three steps required to remove two C-4 methyl groups from an intermediate in ergosterol biosynthesis; mutants accumulate the sterol intermediate 4,4-dimethylzymosterol
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERG25	6321497 upstream sequence, from -1000 to -1, size 1000
CCTTTCATCCGTCTCGTTTATCATAATGATGATTTCACTTATACCTATATGTTTTTTCTG
GCATCTCTAATGTTAGGATGTGAAGTTTAAGTACTCTCCATTCAATGAATACAATTTTTG
ACAATATCTGATTTTACTATGATTAAACAGACCGAGGGAGAAAAAAAAAAGGAACTAAAA
AAGGGCCTACGTAGAAGATGATGTAAAAGTAGATTCGCATCTGAGAATGTTTTCTTCAAA
TTTTTCTTTTCGGCCTTGGCGCAGAAGACTTTCTCTTCGTCCGCGTCGTATAGGAAACAA
AAAAGTGTAAAAAGTAAAAATCGGTATATTACGCAATCCATTCGTTACCCGGTGTAGTCA
CGTGCGGGTGCGGAGGGCAGCCGTTTAAACCCGTTTGGGCCTTGGTCCGATAGAACCATC
TCGCAGGAAAGAGCAGAGCCAGTTATCGGGTGTCGTTTACGCCCAGATGTCGTTTAGCCA
GCTCCGCAACGGCCACTGCCACTACCACTGCCTCCCTTCGTATACGGAACACAGAGATCG
TATACGGTAAACGACTAGCACTAGGACAATAGCAACTAACAATGACCGATAACAGTCAGC
AACCTCAAGGCACCTGGCACAAAACCGTCGAGGAAGAGGCCCTTTGCCACCGTATCGCAT
CGCTTTCCCACCAATTTTTTTTTTCTTGCTTGCCTCGCCTCTGCTGTGGTCGTATTATTA
TTATTCATTCTCTGCGCAGTTTAAACTATATACACACGATTAATCCGTTATGCATGTACA
TTTTCTTGTATGCGTACGCCTGTGTATGCATACTTCTATATAATATATAATACAGGAGGA
TCTATTCTTTTTTTTCTTCTTCTCTTCTTCTCTCCCTTTTTTCTCTCTCTTCGTTTCTTT
CCTTCCAGTAAATCTTTATATTAGTTGTAACTTTTTCTCTTTAGATAGTAGCATAGAGGA
CTAAGGAAAAGTAGTACAGCCATAAAAAAAAGAGGAAAAG
Chromosomal Coordinates Chr VII from 610564-611493
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator