Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ERV1
Systematic Name YGR029W
Description Flavin-linked sulfhydryl oxidase of the mitochondrial intermembrane space (IMS), oxidizes Mia40p as part of a disulfide relay system that promotes IMS retention of imported proteins; ortholog of human hepatopoietin (ALR)
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERV1	6681846 upstream sequence, from -1000 to -1, size 1000
TTCTAATAGCCCTTTACTTCAAGCACCTAGCGGTGTCTTGCTATATGGGCCACCAGGATG
TGGTAAAACCATGTTGGCGAAGGCCCTAGCCAAGGAAAGTGGTGCTAATTTTATCTCAAT
AAGAATGTCATCTATAATGGATAAATGGTATGGTGAATCTAACAAAATAGTCGATGCAAT
GTTTTCATTGGCGAACAAGTTACAACCTTGTATAATATTCATTGACGAAATTGATTCATT
CCTTAGAGAACGGTCTTCTACAGATCATGAAGTTACGGCAACCTTAAAAGCTGAATTCAT
GACTTTATGGGATGGCTTATTGAATAATGGAAGGGTTATGATTATCGGTGCTACTAATCG
GATAAATGACATAGATGATGCGTTTTTGAGGAGGTTACCAAAAAGGTTTCTTGTTTCATT
GCCTGGTTCTGATCAACGTTACAAAATATTAAGTGTTTTATTAAAAGACACTAAACTAGA
CGAAGACGAATTCGACTTGCAACTGATTGCAGACAATACCAAAGGATTTTCTGGGTCGGA
CCTGAAAGAGCTTTGCAGAGAAGCGGCCTTAGATGCAGCAAAGGAATACATAAAACAGAA
GAGGCAGCTCATTGATAGTGGTACAATCGATGTTAATGATACTTCTTCCTTGAAGATAAG
ACCATTAAAGACAAAAGATTTTACAAAAAAATTAAGAATGGATGCTACAAGTACGTTGTC
ATCTCAACCTCTTGATTAAGGAAGGAAAATTAGAAAAAAAAGAAGAAAGCTTTTTATTCA
CGCATCATATCATATCAGATAAGCTAGTTTTCACATAATATGTGTATATGCAGTATACTC
CTGTACATAACTTCCTTTATTTCTGCTTTATAATTATATACTAGTTATTTTTCTTGGGCC
GCTTTTATTACGGCAACTATTCTATCAGGTTTAGTCATAATCTAAATCTAAAGATGGGGA
AAAGCCAAAAACACTCAACTTTCAATGAATACAAAGCTTC
Chromosomal Coordinates Chr VII from 543553-543638,543722-544205
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator