Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name FZF1
Systematic Name YGL254W
Alias NRC299, RSU1, SUL1
Description Transcription factor involved in sulfite metabolism, sole identified regulatory target is SSU1, overexpression suppresses sulfite-sensitivity of many unrelated mutants due to hyperactivation of SSU1, contains five zinc fingers
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FZF1	6321183 upstream sequence, from -1000 to -1, size 1000
TGCGATTGGTGGTACCACTTGTGTAGGACAAACCGGTAACTGGGGTCTTTATTCATGGTG
TCCTGCCATTATGCTAACGAGTTTGACCTTCACTTTCCTTACTGATCTATTCAGTAGCGT
CTGGGTTGAAAGAAAGTATGGTCTTTCCCATGACCATACCCACGATGAAATTAAAGACAC
TGTTGTGAGAAACACTGCAGCTGTTTCAAGTGAGAATGACAATGAGAATGGTACTGCAAA
TGGATCTCATGACACCAAGAACGGAGTAGAGTATTATGAAGATTCAGACGCTACATCCAT
GGATGTTGTTCAATCATTTCAAGCACAATTTTATGCCTTTTTAATTTTAGAATTCGGTGT
GATTTTCCACTCCGTTATGATCGGTCTAAACCTGGGAAGTGTTGGTGATGAGTTCTCCTC
CCTATACCCTGTCTTAGTGTTCCATCAATCATTTGAAGGTTTAGGTATTGGTGCAAGATT
GTCAGCCATTGAATTCCCTAGATCAAAGAGATGGTGGCCATGGGCCCTATGTGTTGCGTA
TGGGTTAACCACACCAATCTGTGTGGCCATCGGTTTGGGTGTTCGTACCAGATACGTCAG
CGGTTCTTACACTGCGCTTGTTATCTCTGGTGTTTTGGATGCCATTTCTGCTGGTATCTT
ATTGTACACTGGTTTGGTTGAACTACTAGCAAGAGACTTTATATTCAATCCTCAAAGAAC
AAAGGATCTAAGAGAATTGTCCTTCAACGTTATATGCACTCTTTTCGGTGCTGGTATCAT
GGCTTTGATCGGTAAGTGGGCTTAAACCAAAGCGAAATTCTGCATGTTCCATATAGATTC
TATTTCATATTTTATAGTTATTTATTCTTTAGTAATAGCAAAAAAACAGTAATAATTTTT
CTTTAACAGTCTCGGACAATAAATACGCTAAAGAAGATGAAAATGACAACTTTTACGCTG
GTGTGCACAAGTGGTACCAGAATACGTGGCCACCAAAACA
Chromosomal Coordinates Chr VII from 22304-23203
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator