Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GUS1
Systematic Name YGL245W
Alias GSN1
Description Glutamyl-tRNA synthetase (GluRS), forms a complex with methionyl-tRNA synthetase (Mes1p) and Arc1p; complex formation increases the catalytic efficiency of both tRNA synthetases and ensures their correct localization to the cytoplasm
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YGL245W	6321192 upstream sequence, from -1000 to -1, size 1000
AAGCATTGCAGCCAGGTCCGGAACAGTTTACGCTCAAACTTATGCGTATCCGATATGTTC
GCAACTTGCTGCGTACATTTCAATTCGGCATAATGTTTTAAATTGTCTCTACCGTTTTCT
TTAAAGTCAAATATACAATCCACCTCAGCACCAAGAATTAACTTGCAGTTACCTACACCA
GTTCTCACAACACTAATGTATTCATCTCCATGCGATACAATCCTTTTAGTTCTTTTTTCT
ATCACTTCACGGGGTGTATACTGCAACGGATTGGAAAGAGTAGCCAAAGTTTCAAACTTG
TACCCTGTAAATACATTCAGATCTTGATTTATATTACGCCCTGCTTCAGTTGCAGAGGAA
GCCTTAGCTGCATTGACAGCTTCAGGCACTTCCTTGATAAAAAGTTGGCCGTTGAATGAA
ACGATACGAAGATCAACTGTATTAAAAGATGGAGAGTCAAATGCACATGAAATTAATTTC
CGTGCTATTCCTCTAAAAGTAATTATATCAGCATTAATTTTTTTTCCTTTATGTCTTTCA
GAGCTTTCTATGGTTTCTAATAGCCCACGCAGGGAACACCTGTCTTCAAAATCTTTGTAA
TAATCCTTAAATTTCTGAAATCCTGATGAAAGATCCAACTTCCTGTCCAATTCAGCGTCT
GGAAGATAGTAGTAATTCAAATTCGTATCATCGCTAATTAAATATTCTTCATCCTTAGTT
CTTGAATAGAATCCTATTTCCTTTGGCTGCTTCAGAGCTGTTGTCGACCCTCTTTGCTTT
ACGAACAAATTTGCACTAACACCCATTGGGATACACTATGTTGGTCTAATATTTCGCTAT
TCTTTCACCATATTACAGAAGTATTAGTAACATTACCAGACCTCATCTGTTCCTAATATT
CTCGAAGTAAATTTTTCAATTTACCCGAATGCTTACTCTTTTTTTCTTCTTCGTTAAAAG
CAAGATAAAGTGAAAAAAATGGAAGATAACTTCCATAAGA
Chromosomal Coordinates Chr VII from 39023-41149
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator