Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SKI8
Systematic Name YGL213C
Alias REC103
Description Ski complex component and WD-repeat protein, mediates 3'-5' RNA degradation by the cytoplasmic exosome; also required for meiotic double-strand break recombination; null mutants have superkiller phenotype
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SKI8	6321225 upstream sequence, from -1000 to -1, size 1000
TCCACGTTGTGCCTGGATAATTCGGTGCAGTGCAACCAACTCTTGTTCTTGATCGCGCAC
CATTTGCATCTGCCCCTGTTGCAAATCGTTATTCGTTCTTCCTTGAACTTCCGTGGTTGA
AGAGTTGTCACTGGTGGCAACCCCCAGAAGTCGTCCACGGTCCTGAGCTATGTTTGCTGT
ACCAATGTCATCGCATTCCTTGAGCAAGGACCTCAATAGAGCGGCGCGACGAGTCACTTC
CGTGCTTGGAAGAGACTTCTTTTGCACATCCTGTTCTAGTCGCTCTCGTAACTTGTGGAG
CTTCGTACGTGCCCTTAGTGCTCCACGCACGCTGGGTGTGCCATCACTCTCCTTATCTAA
ATCCAATTTAATATCTCTTATCATCTCATCCCATCCCACTTCGTCAGCAGTTTCTAGATG
CTGCTGTGACTTTTCTTGAGAAACATTTGGCTTTGACAACTGCAGGAAGTCTTGCGCTAT
TTTTGTGTCTCTCCATCGAGAATCAAAACGATCGTTATACAATTCATTGAGGAACCTCTC
TAGTCCGATCCGTCTTTCATCGATCATTTCCGGATCATCATATCTTCTTTGCCACCTCCT
GTCCAATACACCGGGCTTTTCAGGGAAGTCATATGGGATGGTGCTTCCTACATCTCTCTC
CAATCGTGTCTTCAGTTTCCAAAACTCGGAATACCTTTTGTAAAGGCGCTTGTTTGGTGT
ACTAACACCGTATAAAACATACTTGGGGTTGATTTTAACATCGTCCACCTTGATTCTTAA
CTTTTCACTCATTTTCCCTACAGAATTAGCTGCCATCAATATCAATTATCAACCCTTATA
TGACTTTATTGTTTTTGTTTTTGTTGGCTAATTAATTGATACAAATCTTTAGGCGAAAAA
TAAAAAAAATATAAAGTAAAGAAGGAAAAATTAGGCGATATTAAAACAAATCTAAAATAA
AGACAAGAAACGAAAAAGAGGTTAATCAAGTATTGGAAAA
Chromosomal Coordinates Chr VII from 91247-90054
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator