Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SIP2
Systematic Name YGL208W
Alias SPM2
Description One of three beta subunits of the Snf1 serine/threonine protein kinase complex involved in the response to glucose starvation; null mutants exhibit accelerated aging; N-myristoylprotein localized to the cytoplasm and the plasma membrane
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SIP2	6321230 upstream sequence, from -1000 to -1, size 1000
ATGCCAATTTCTACATACACTCCAGTTCCATCGCAATCATTCACCTCTTTCCAGAGCTCT
ATTGGCTCCATACAGTCAAATAGTGATGTTTCATCTATCTTCTCGAACATGAATGTTCGC
GTAAACACTCCACGCTCTGTGCCAAACTCTCCGAATGATGGATATTTACACCAGCAACAT
ATCCCACAGCAGTATCAGCATCAAACTGCCAGCCCTTCTGTTGCCAAGCAGCAGAAAACT
TTTGCACATTCTCTTGCATCTGCATTATCTACCTTACAAAAAAGAACGCCTGTAAGTGCC
CCTTCCACCACTATAGAATCACCATCCTCACCAAGTGATTCCAGTCATACCTCTGCATCC
AGCAGCGCTATCTCTTTGCCTTTCAGCAATGCTCCTTCTCAGCTCGCCGTGGCCAAAGAA
CTTGAGTCCGTCTATTTAGATTCCAATAGATACACCACCAAGACTAGGAGGGAAAGAGCA
AAATTCGAAATTCCTGAAGAACAAGAAGAAGATACCAATAACAGCAGCAGTGGTAGTAAT
GAGGAGGAGCACGAGTCGCTAGATCATGAATCTAGCAAAAGCCGAAAGAAATTGTCAGGC
GTAAAATTGCCGCCTGTACGTAACCTACTGAAACAAATTGATGTTTTCAACGGTCCCAAA
AGAGTTTAACCTTTACGGCCCCTTTTTATCTCACCATTTTTCCTCTAACGAACTGTCATG
AAACAACTTAGCATATAACGCGTACTTACATAGATAGATTAAATAGATAACCATGCATAT
CACTAACTAGCATCGTCATGAATAGCACGTTTACCTATACGAATTGCGGCCGGCATGGTC
TTTTATATTGCTCCCTTGGACCGAGTAAAGATTTACCTTGCGTTTTCGGATCGTCAAAAT
CTTTTAGGGAAAGGATAAATACACCACAAGATTCCTGGGAAATGAAAAGTATCTGAAATA
ATTGTGCTTTTGGAAGGGTACTGAGAGCAGTGAAGTTTCT
Chromosomal Coordinates Chr VII from 97338-98585
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator