Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SAE2
Systematic Name YGL175C
Alias COM1
Description Endonuclease that processes hairpin DNA structures with the MRX complex; involved in meiotic and mitotic double-strand break repair; phosphorylated in response to DNA damage and required for normal resistance to DNA-damaging agents
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SAE2	6321263 upstream sequence, from -1000 to -1, size 1000
AGCTTTGCACTTTCTTCTCATTGATCTCATTTTGCTTAGCAAACCATTTTTCTTCAAAGC
CATTTGATCTGTGGACACCGTCCCATCTTGACCCAGGCATAATGGCAAACCTGTTCTCAG
GTGCTGGCTTATCATAAAGCTTGCGGCCCAGTAAAGATGTTTTTACAGTTCTTTCTTTGT
CATGTGTAAATGTTATTGCAGGGTCTTCTATCGTCAGACTCGAGGCAGTTTGATTTTTCT
TCTTATCATGTGCATCTACATTTATTCCAAGCTTTTGCACGTCTCCCATATTCAAATTTT
TCAGGTATTGCTCTCTTTCCGCGGCTTTCTCATCTTCATATTTAGATCGACTAAAACTAG
AATCGTCTATCTTGGAATCTTCCTGAATCTTGTGACCTTGAGCGTCTCTGTATATGGTTT
TTCGTGTTTTCGATTTGTCTGCTACTGTGACAAGTGGCTCTTGAGCCCTGATTTCCTTTA
GATCGTTCTTGCTTTCGTTGCCAGTAATTGACGATGCGGAAGGATGTGTTATTGCATGGG
AAAGCTCGTTTGTTTCCAGGTTCTTCCATATATTCTTGCTTTTTTGTTTGTCAAACTTGC
TGAATGAAGCAACTCCTGACTTCTCCTGTTCTTGTTGCAGTGTACTTAGCCGTTCTTTTA
CTATCAAAGAAGTTTTGTCTGAGTTAGCGTCTGATTTTGACTCTTTCTTCTTCTTTTTCG
TCTTATTTTTGGGTTTCGTGGGCCCATAAGTCTCTGATAAATACTGATGCAATGCCATGT
AATAAACGTCCTGTTGTTATCTTCCACCATTCGAGTCTTGAGAACAACTTTCAAAATCAA
GTCAAATAGCCATTTTCTTTATGCCATTTTCTAAGCGCGTTCTACAAAAAAAAAGCTTTT
AAGCTTTAATACCTTTTTTGTTTACGTTTGCAAACATTGTTATCGTTCACATACCTGCAT
TTCCATCCATGCTGTAAGCCATTAGGTGTTTGTATGTGAG
Chromosomal Coordinates Chr VII from 174322-173285
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator