Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name NUP49
Systematic Name YGL172W
Alias NSP49
Description Subunit of the Nsp1p-Nup57p-Nup49p-Nic96p subcomplex of the nuclear pore complex (NPC), required for nuclear export of ribosomes
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NUP49	6321266 upstream sequence, from -1000 to -1, size 1000
CTCCGTACCTGGAGTAATAGAATTCGAATCAAATGGCTCACCCTTAGGAATCTCGTCACC
ATTCTCAATAGCCTTCTTCAAGGCTTTTTCTGCATCCATAGCGGTTCTGAATCTACGAGC
TCTTTGTTGATTCATCTTGGCACGAGGGGCCACACCATCAATAGCCATGTAGAAAATCTT
CTTGGGCTTGATTGTTTGAAAAAGGTGATCGATATACGTACAGATTTTTGCAAAAACCTC
TTCTTCAGTTAATCGCTTGGTTACATCATCGTCGTTACCATGCGTACAATTATGTAAAAT
CGAATTCATATCCAGGTATAAGTTATCAAACTCAGGAATCTGTGTTCCCTCAATAAGCTG
TAAAATCATGGGCCATCTTTCTGAGATGTACCTGAAAAATTTTGGAATACCCATACCGTA
CTGATATATATTTGTTGCTGCTGTTGTTACAAGTGTTGATTTTTTTTCTCCTTATAGTAC
ACGAATCGTCCTAGGATTAGTCAATTGCTTATTGTGAACCCGATTATAAGTACGGAAGAA
GACAGTATCCTTTAGAAAATAAACTATTAACAGGAACGGAAATAAAAGGCAGAGAGAAAA
TAATAAAAGAATCGGTTCGCTTGTGCGAACGCCAAACAGATTTTATAATAACGGAAGAGC
TGCTGAAAAAAAAAGCAAGCTGCAACTGTTATATTTGCGTAGATAAACTTTACAACCGGT
AATTGGAAGTCGTAAGTACTTAGTTTGACGTTTTCAGTACTCGTTAAACTACTCCTTAAA
TTGCTTTCTAACCTCTTCTTGTTTGTCTCTGTTGTTACTTGCTCTGCGGTGGCGAAAAGA
CGAGCAAAGGAGGTTGTATATATCACTCAACACGGAATGTATTACAGCTTTCTCAAATAA
ATGTAGTTGAAAAAGACCATTAATCGTGAGAATAGTTACTGATCAGGTGATGAGACGATA
AAAACAGTAATTGAGAGGGTTTTCACGGGTAGTGGGCACA
Chromosomal Coordinates Chr VII from 180700-182118
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator