Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ROK1
Systematic Name YGL171W
Description ATP-dependent RNA helicase of the DEAD box family; required for 18S rRNA synthesis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ROK1	6321267 upstream sequence, from -1000 to -1, size 1000
TCAGGCGGGCTATTTGGTAATCAGCAGCAGCAACTGCAGCAACAACCACAAATGCAGTGC
GCATTGCAAAATCTATCTCAGCTCCCTATTACCCCAATGACACGGATTTCCGAATTACCA
CCTCAAATACGTCAAGAAATTGAACAACTAGATCAATATATTCAAAAACAAGTGCAGATC
TCGCACCATTTGAAGGCCGATACAATCGATCATGATGAATTGATAGATTCCATTCCTCGT
GATGTTGCATACCTACTGAAGTCAGAATCTGCAACAAGTCAATATTTAAAGCAAGATTTG
AAGAAAATATCCTCATTTAAATCGCTAATCGATGAGGACCTTCTAGACACGCAAACTTTT
TCGGTGCTCTTACAGCAACTATTAACTCCGGGAAGCAAAATTTCTTCTAATGACTTAGAC
AAATTCTTTCAAAAGAAAATTCATCTCTACGAGAAGAAGTTAGAGGATTACTGCCGTATT
CTCTCTGATATAGAAACTGCGGTAAATGGCATTGATACAGATTTATTTGGCGCCCCAAAT
AACCCTAATTCTACAGCTATCACAGCAGATCTAGGTTCATCCGAAGCAGAGAACCTACTG
CAGTTGAAGACAGGCTTAGCTGCCATAGTCTCTACTGTCATTGAGGAATTCACACTGTTT
ATGGATATCGCTGAGAGAATCGCCGTGTTACATCAAAAAACGAAAACACTGGCATCATTG
AGCATATGAGTAAATCGCCCTGAAAGTTTATATAGTGCGTATAACAAGTACAAATGTCTT
GTACAAATGTAATTTATACTAAATGCAATAGAATATAACATCAATCACAGTTTTTCAGTC
ACCATAATGGCGTCTTAGAGGCCGAACTAACTTTTCTTCGTGAAAAATTTTTTGCGATGA
GATGGGAAGGAAAAAAAGTAATATTGACATCTTCAATTGAGAGATATTACCTGCAAAAAG
GTACATACGATAGTAGAAGTTATCGAACAGGCAAGCCACC
Chromosomal Coordinates Chr VII from 182390-184084
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator