Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name PMR1
Systematic Name YGL167C
Alias BSD1, LDB1, SSC1
Description High affinity Ca2+/Mn2+ P-type ATPase required for Ca2+ and Mn2+ transport into Golgi; involved in Ca2+ dependent protein sorting and processing; mutations in human homolog ATP2C1 cause acantholytic skin condition Hailey-Hailey disease
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PMR1	6321271 upstream sequence, from -1000 to -1, size 1000
CTGCTTCATCATTTGCCCTTCTGTGGCATGACCCTCCCTTTGATTTCCGGCTGCTTTTCC
TCTTGGTATGACATTTACAAGGTTCACCCTCATCACAACGACATCGTGTTTCATCTTCCT
TGCTGCCAACAGCTGGCCGTCGTGCAGAGGCACACATGCACCCACCGGATGGGTTGAAGT
TCTTGGTTCTTCTCAGCTCTTTACAATGGCCACATGTGGTCGATGGTCTTCCCTTGCGTC
TGATCATCTGTAGCGGACCATCAGTGTGAGTACACTGCGCCGCCCTGTGACCCCTGATAC
ACGTTTCACAGGCATATTTGACCCCGTTAATTACGACCATTCTGTGAATACACTGATTAT
CAGTCCTCTTTTATCAAGCCGCCGTCTAATAAATTACATCGCCATGGCTACTGCTATTTC
GTCCACAGCTTAATACTTACCGAACCAGGCCTTGCGGCTCTTACCCTGCGTGCCCGCGCA
CCCTGGCGACTTCGCCTCGTTTTGGCGATTTTCTTAGCAAATATTCTTTCACGATCGTAG
TGGTGGAAGGTGGGTGAAAAGAGTTGCGTTCCTAGCAAGGATCGGTTGGTATCAATTGCA
CGTTCAGCTCATCCCTAGATAACCACTTAACAGCAAAGCCGATCGTTAAACTTTTGTATT
CTACATTCTAGTTGCATTTTTTTTTTTTTTCATTTTGTTACATCAAGACAAGATTCTCTA
TTTAAAGAAGTACTTTTTTTGTTAACAGTGTGGACCCTACCTATCGTTATATCGAGATCT
TGTTCCCTAGGCCATCGTACACTATAGCCCTTCCTTCAAGCACTTAATAGAAAAACCTCT
TTTTCTACACCATCATAATAGTGTTTGCTCGCCCCGTTCTTTCCATTCCCATTTATAACA
ATACTAGTAACTATAATAATATCCTTACGACTGGGCAAGACAAGACGAAGCAAGGCCAGC
ACAGACGTAAGCTTAAGTGTAAGTAAAAGATAAGATAATT
Chromosomal Coordinates Chr VII from 190468-187616
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator