Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GPG1
Systematic Name YGL121C
Description Proposed gamma subunit of the heterotrimeric G protein that interacts with the receptor Gpr1p; involved in regulation of pseudohyphal growth; requires Gpb1p or Gpb2p to interact with Gpa2p; overproduction causes prion curing
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPG1	6321317 upstream sequence, from -1000 to -1, size 1000
CTTATGAATATGGTATCCATAAGTGGTGCCGTGACCACTATCTAAATTACAGGTCCCTTT
CCGCTGCTGATAATATCCGCTCCCAATTAGAAAGATTAATGAACCGTTACAACCTAGAAT
TAAACACTACAGACTATGAAAGCCCTAAATACTTTGACAACATCAGAAAGGCTCTTGCGT
CTGGGTTTTTCATGCAAGTAGCAAAAAAAAGATCGGGAGCTAAAGGATACATCACAGTTA
AAGATAACCAAGATGTTCTGATCCATCCTAGTACGGTTCTTGGCCACGACGCAGAATGGG
TCATTTACAATGAATTTGTGCTCACATCGAAGAACTACATAAGAACTGTGACCTCGGTCA
GGCCCGAATGGCTGATTGAAATAGCGCCTGCATACTACGACTTAAGCAATTTCCAAAAAG
GTGATGTCAAATTATCTTTGGAAAGGATCAAGGAAAAAGTTGATAGATTAAACGAGTTGA
AACAAGGTAAAAACAAAAAGAAGAGTAAGCACTCCAAGAAATAGACATTTTGTGTCGAAA
AAAAAAAAAAAATAGATTTATATAAATTTATAGGACTATTTCATAGAGAGAAAATTCAAC
TAGAAATAGGTACACGTAACCTAAAGCTGCTTGTACTAAAATCATAGCGCCCTGTATCAA
AAAGAAGCTTTTTTCTTTTGTTGGGTATGTCTATATAGAGCACATCCTATATTCCCTTCG
AGGTGTTTTTACAAGAACAAATAAAGAAACAAACCGCGGTGTGAGGAAGTTCCCTTAAAA
ATGGCAAAGATTACCGTAAAGGTAAATTACTCCTTTAACGATGCTTAAAACGAGCATCTT
ACTCTTGCAACGAAATTAATCACTCAATTTCAACGAGGATGTTGGCTTCCCATCAAAGTA
GTTTTGGGGTAAACCGCATATATCTGTATATTAAGAAAACTTATTTTCCACTATCTAATT
TGAACTACAGAGAAGATAAGAAATCTTTTAAGTAGCAATC
Chromosomal Coordinates Chr VII from 281157-280777
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator