Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SLD3
Systematic Name YGL113W
Description Protein involved in the initiation of DNA replication, required for proper assembly of replication proteins at the origins of replication; interacts with Cdc45p
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SLD3	6321325 upstream sequence, from -1000 to -1, size 1000
TATTCGAGCACTTGGAGAGACCGATCTGAATCCTGTGAGCGGCATTGGTAAGATCTCTCA
ATTGATTTTTGCCTTTATCATACCAAGGGATAGACCTGGATCAGTGTTAATGAACGTGGT
ATCGGGAGGTATTGCAGAAGCCTCTGCCCAACAGGCGGGCGATTTAATGCAGGATTTGAA
AACGGGGCACCTCCTCGGCGCCTCCCCAAGAGCTCAGTTCTGTGCCCAATTGATAGGGGC
CTGTTGGTCAATTATTTTGTCTAGCTTCATGTATTTGTGCTACAATAAAGTTTATTCAAT
TCCGAGTGAGCAATTCAGGATACCGACAGCAGTAGTGTGGATAGATTGTGCAAGACTAGT
AACTGGTAAAGGGCTCCCTGATAAGGCCTTGGAGTGCTCCATGATTCTCGGAGTCATATT
TGCCGTTTTATCATTAATCAGAAACACTTATAGAGATTACGGATACGGGTGGATATTATA
TATTCCGTCTGGTGTAGCAGTCGGTGTTGGTATATTTAATTCTCCCAGTTTTACAATTGC
AAGATTCATCGGCGGGTGGGCTTCGCATTTTTGGTTGAAGAATCATAGGGGTGACTTAAA
TGCGAAAACAAAAATGATTGTATTCAGTTCGGGGTTGGTCTTAGGTGAAGGTATCTTTAG
CGTAATAAACATGCTCTTCATCTGCTTAAATGTCCCTCACTATTAGGTATATAATATTTT
ACTAATAAAGAATTTACAAAGTTTACAAATTTTAAATTATTTACTCATCACATAATTCGA
TGTCTTAGATTTCCCTGTATATATATTTCTAGGTGACAAAAATCCTAGGCAAAATGTTAT
ATTATACGCGACCTTGAAATATCGGCTATCTTGGTGTACAACATGGTCCATTTAAGAAAA
ATAAAAAAAAGTGATGGGCACTGTTAAAACAGGCAGAAGCCTCATTCATAACTGCTGAAG
GGTTAAGATCGTATAGGTAGGAACGATCTGACCTCTCATA
Chromosomal Coordinates Chr VII from 295932-297938
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator