Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name SEH1
Systematic Name YGL100W
Description Nuclear pore protein of the conserved Nup84p complex (Nup84p, Nup85p, Nup120p, Nup145p, and Seh1p); part of the SEA (Seh1-associated) complex, a coatamer-related complex that associates dynamically with the vacuole; homologous to Sec13p; the Nup84 subcomplex has a role in transcription elongation
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEH1	6321338 upstream sequence, from -1000 to -1, size 1000
TAGGGAGATTTTGGCAATTCTTTCGAAACCTCACCCAAATTATCAGTTAGCGTTTTTGAA
TATTATACAACTTTTGAAAACGCAAAGAAGAACTGGTTGGGTTGACCATGGTATTGACCC
ATGCGAAAGTATATCTGACCATATGTACAGAATGGGTTTAACTACCATGCTGATTACGGA
CAAGAATGTTGATCGTAACAAATGTATCAGAATCGCACTTGTTCACGATTTTGCGGAGTC
ATTAGTTGGTGATATTACACCTAATGACCCAATGACAAAGGAAGAGAAACATCGCAGAGA
ATTTGAAACTGTCAAGTATCTCTGTGAAAGCATAATAAGGCCCTGCAGTGAAAGCGCATC
TAGGGAAATTCTTGATGACTGGTTAGCATACGAAAAGCAGACCTGTTTGGAAGGAAGATA
TGTCAAAGATATTGATAAGTATGAAATGTTGGTTCAATGTTTTGAGTACGAACAAAAGTA
TAATGGCAAGAAGGATTTGAAACAATTTTTGGGAGCCATCAATGATATAAAAACTGATGA
AGTTAAAAAATGGACACAATCTTTACTGGAAGATCGACAAGCCTTTTTCGACAGTTTGAA
GGAGTAATAATGTGGCCTTTTGAAAGAAAAGTTAGTGCTTTTTTTTCTTTTCTCAAACCT
TCACCTGGTGGTGCGTATCATTTATAATAACATCTTGATGCTTTTCAACGAGATAGTGCC
CATTTTATTTTGCATGTATTATACTTCCAGCACCCGGTGTGCATTATATGTAACTTTAGA
AATAATCTTTTGTATATTATTCGCGATTGAATGTGCGTGCTGCATTATCAACCAAGTTTT
AATATATCTGTTTCTCTTATTTATTGTTAGTTAAGTCTTCGGCAAAACGATGGAAAAAAT
CATGAACTGAATAGAGACAAGTAAACCAAATTATAAACAAGGTTTCCCTTCTGAAGAGAT
ACTAAGGAAGAAGAAGAACGACCCAATAATATTTCTGAAT
Chromosomal Coordinates Chr VII from 313234-314283
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator