Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RIM8
Systematic Name YGL045W
Alias ART9, PAL3, YGL046W
Description Protein involved in proteolytic activation of Rim101p in response to alkaline pH; interacts with ESCRT-1 subunits Stp22p and Vps28p; essential for anaerobic growth; member of the arrestin-related trafficking adaptor family
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RIM8	27808707 upstream sequence, from -1000 to -1, size 1000
TACTCATATCACAGCCACTGTTGCACTACATTATTCGCAGGGACTCCGAGATCGCTGAGC
ATGTTGCTAAGCAACTTACCAAGGTTGGAATGCATTATATAGTCCGATATAGACCCCGCT
CGGACTATATTATATAAATTCAAATAGCACTTTCAACGAGTGTCTTAATCCGTCCTAGTT
CCTGCTCTCGCTCCACGTTGTCATCCCACCCATTCGCACGGGTCTTCTGTGCGAATGAGC
CACAACGGGGCCGAGTTCAGGCCGTGTCCGCCTACAACGTCCGCCAACTAGTGGCAATTG
CTACGTACGCCGACCACGCTGACACGCACCGTTCTACTCGCTCTATGCTGCGGTGTGACG
TGTGAACGCGCGATCGTTCGCAATCGTATCGTTTGCCAAGAAAAAAAGCCAATCGGAGAA
TCTGAAAATCGCTATTCGGCTTGCAGGTCGCACGCACTCAGAGTACGAAATGCCAAGTAC
CGGAATTTCCTTGGCCTTTTTTAAGTTTCTTCTCTTCTATTCTTTTTCCCCTTTCTTTCT
TCCTTTGCTATCTGTCTGGTTTAAATAAACATAGTATTTTTTTGTGTCTAAGCCTCTTCC
TCTTCTCTCGTACTTGCTCTACTACCACTTTACTTAATCGCCTTTCTTTGTTTTCTTTCT
TCGTTATTTGTTCTTGGAACTTTTCCGCTCCAATCCCAACGATTGGCTTCAAAACACGTT
CTACTGTCTAGCAATTTCTGCAGGTGCCATTTTTCTTAGGCTTATACCCTTTCCTTTTCC
CCTTACATTTGATTTCTTCTTCAAAGTTCCTTATAGTATTATTGTCTAAGCTCTATTGAG
TCAAAAGTAACAATCTAGACGAAGGAAAAAAAAAAAATAGAAAATAGACATCCCCGAATA
CGCATCATCTCACGCACGTACAAGATTTTAACGTTAAAGCCAAAGTACGCTAGTATAGTA
TCATCAGCATCACCCTCACTATCGGTAGCATTGACCAAAC
Chromosomal Coordinates Chr VII from 414102-415730
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator