Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name HEM2
Systematic Name YGL040C
Alias OLE4, SLU1
Description Aminolevulinate dehydratase, a homo-octameric enzyme, catalyzes the conversion of 5-aminolevulinate to porphobilinogen, the second step in heme biosynthesis; enzymatic activity is zinc-dependent; localizes to the cytoplasm and nucleus
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HEM2	6321398 upstream sequence, from -1000 to -1, size 1000
GATTCTATTGAAACGACACCATACAGCTCATACGAGTCCGGTGTACTGGCACAGAACACA
GATGACAATACAAAAGTAAATAAATCTATCGACAGCAATTCCTATTTTCTTTTACATTTA
TATTGATTAGCTTACGATTTCTGTATTTATAGAGCGTGTAGTTACATATCCAGATACCTG
TCTTCTAGGTGAACAGTTGGTTTTCAGTTCAAAAATTATATAGGATCTTGGACGGTTAGC
TTTCCTCCTCATGATCCACTCTTTCGGGAACAAGATAAATTATTGTTTAGTTTTGATTAG
CTTTACTTTAATTCGCACAAAAAAAAGCCTGCATTGTCACGAGAACATTGAAACATATAC
AAAAAACAAATTTGAAATAGAAAACAAAGCAATTTACAGAAATGACTGCCTGGTGCTAAT
TCTTGCATATATTTTATTTTTAATTAACTAGAAATCAGCGTCAATTATAGTTTCTGGTGA
GTCAGCCAATGTCTGTAAATAAAAACAATATGCTTAAGAGGATTAACAGTGGCACAAGAG
GCAAAGAAGGGAAGAAGGCGTACACGTCCACATGAATATATAAAAAAGAAGTGTTACATC
AATTGGAACCCATCTTTCGGAACGTTTTCTATCTGCTACAAGCCTGTGTCACCGAATTAC
TTTATTGGGTCTTGTAGAGACGCCGAAATACATCATCATTCCAAGATCGACGATAAAAAT
CATCCAAAAAATTGTTGCCGAAAAAAAAATTGGAAAAGGTGAAAAAAAAATCAAAATACG
GGTAAACGAGCAATCCCTGTTCGGTGCGGTGATTGGCTTGAGGCAAGCTTCCCGCTTGAT
TTATATAAGAGTAAGGCAACCTAATAAATGCTAGCAACATCTATGCGCCACTCTATTGTC
TTTGATTTTCTTGCCCAATCAGCCAAATAAAAAAAAGTTTTACTGCTTACTCATATTATT
GCTTACTCCAGTAATTCATACCTAGAAAATTGACAAAACC
Chromosomal Coordinates Chr VII from 420555-419527
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator