Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL30
Systematic Name YGL030W
Description Protein component of the large (60S) ribosomal subunit, has similarity to rat L30 ribosomal protein; involved in pre-rRNA processing in the nucleolus; autoregulates splicing of its transcript
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL30	6321408 upstream sequence, from -1000 to -1, size 1000
GAAATATGGACTTTTTGCAAATTCAGAATTCATTTTACTAGGTTCTTGCAACATGGATAA
CATCTCACGCTGTTATTTTTCATGCTTCTCCATATCGTATATATGTAATGAAGCATTTTC
ATTGGGTTTCCTGCTCAAAGGTTGACATATATTATAAGTTATACTGGAACAAGCCACAAT
CCTGTCAAAGTCTAAATTCCGGTGTATTGGCTATCTGAAGCTCTCTCATATATTAATACA
TTGCTTTCTAGCACAACGCTGCCCTCGGTCGCCATTAATTATGAATCATCATCATATAGG
GACATACCTCTCAAGTTATTGTCTTGGTGTCTTGCTTAACTTGGCAATAGCAACAGCGCA
AACTGCGTAAACGTACTAAAATACACACCATCCGTTGAATATATCATGCAGTACATTGAC
AGTATATCACTTCTGGATAGGACGCCAACCGCCAGTCTGTGTGGTATTTCCTCCCGTCTC
TGCGTGCCAGACGGGATCAGCCCGTCTATTCTCGTGTCGTCCTGCCTGGAGAGACTGAAC
CCCCATCTAGCACCGCAGTAAGGATCATTACTTTGTAGGCGGGAAATAAGAGGTTCAACA
AGGACCAAAAAAAAAAACACTAAAATCTGAGATCAAAAATATGTGGTGCACAGATGTAAC
GTTCCAAAATGTATGGATGGTAAGGTCTTTTTCCAAGAAACGTATCTTTTTTTCAGCTAG
GGCCGCATTTAAATTTTTTTTTTTTTCAATTTTTTTTCCTATTGGAGACGGAATGGCAAA
GCTCACGCTGGGCGATAGCACGTAACCACGCTGGTGTATTTTCATCCTAATCATTCTCTT
TCATCTATTTCGATAAGCTACTTAATGTCGAAGTTTTAACTTCCATTTGTTGGAATGTTC
ATTACAGTTTATACTTACTCCTTGCTCTTTTATAATATAACCAAACAGACCGGAGTGTTT
AAGAACCTACAGCTTATTCAATTAATCAATATACGCAGAG
Chromosomal Coordinates Chr VII from 439091-439093,439324-439638
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator