Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name TRP5
Systematic Name YGL026C
Description Tryptophan synthase, catalyzes the last step of tryptophan biosynthesis; regulated by the general control system of amino acid biosynthesis
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TRP5	6321412 upstream sequence, from -1000 to -1, size 1000
CAACCACTCTGCGGCCGCTTCGACACCCACCACAACTGCCACCCCTCATGCAAATCCCAT
CACACATGCGCACTCGCTTTCGAATCCAAATAGCACCGCTACAATGCAACATAATCCCCT
GGCCGGCAAGAGAGGTCCAAAAAGCGGTAGTACTATGGGAACTCCAACCGTACATAATAG
CACTGCAGCTGCACCGATTGCGGCACCTAAAAAGCCAAGAAAACCAAGACAAACCAAGAA
GGCAAAGGCTCAAGCTCAGGCTCAAGCGCAGGCTCAAGCGCAGGTCTACGCACAGCAGTC
GACTGTCCAGACGCCAATAACAGCATCGATGGCAGCCGCGCTACCCAACCCAACTCCTAG
CATGATTAACAGCGTTTCGCCCACAAATGTTATGGGCACGCCGCTGACCAACATGATGTC
TCCCATGGGGAACGCATACTCAATGGGAGCTCAAAACCAAGGGGGACAAGTATCTATGTC
ACAATTCAATGGCAGCGGCAATGGATCCAATCCAAATACAAATACAAACTCCAATAACAC
CCCGCTACAGTCACAATTAAACCTAAACAATCTAACCCCTGCTAATATCCTAAATATGAG
CATGAATAACGATTTCCAGCAGCAGCAGCAACAGCAACAGCAGCAGCAGCAGCCTCAACC
ACAGTACAATATGAATATGGGCATGAATAACATGAATAACGGGGGGAAAGAACTGGATTC
TCTAGACCTGAACAATCTGGAATTAGGTGGTCTGAACATGGATTTCTTGTGACTGGTGCA
TCTATGTATCCAAGATAGTAATTATCTGTATAATCTTCTATTCTTTATACCTTATTACCC
GAAAGGCTTTTCTTTTTATTTTTTATTTTTTTTCACTTCTTGACCGTGGAAGAATGACTA
ATTTTACTATTTGTCATATAAGAATCATCGAGATTCTTACACTTTTTATGGACTGTAAAC
ATCGATTGCTCCAAAAAGGGACATAGCACACCGACAGACC
Chromosomal Coordinates Chr VII from 448535-446412
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator