Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ATE1
Systematic Name YGL017W
Description Arginyl-tRNA-protein transferase, catalyzes post-translational conjugation of arginine to the amino termini of acceptor proteins which are then subject to degradation via the N-end rule pathway
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATE1	6321421 upstream sequence, from -1000 to -1, size 1000
CGAGTTGAAAGTTTTTGGGTTCAGGATAAATGATGAGGCAGTATCTGGTCCTAGAATGAA
GTGGTTGAGACAATATCCATCCACGGAGGAGGACTGGGAAGAATTTGCCAAATGCGAGTT
CGAGACACCGGCGGTTTAACCCTTGATTTATTTTCCTCTTTGCCCTACCATATACATATG
TACTTTACCTATTTACATTGTTTCAGTTTTTATATCACCACTATTATTATTATTACTATT
ACCACTTTGGAGTACTTTAGTGATTCATTTCCAATTGTTTTCCTGGAGCCCAGTCTTTGA
ATGCCTTGGCCAAGTTGTACCAGTACTTTAGCTCCACGGTCAACTTCACTGCGGCGGCGT
AATCCTTGTCATTGTAGCATTGTCCCAACTGGGCTTCAATATCTTGAATTCTTTCCTTGT
TTTGCTTTTCAAGCAGCTTCACACCAGCTTCGTCGTCCATCTGGGATAATTCATCATGGA
TGTCTAGAACTTTCAATAGTAACTGTGGATCACTGGTAGTTACTTCATTTGAGGTCTGTT
CTTGCGTCAAATCGATATTGCGCAAGAGTTTTAGCATATATTGTGACCTTCTAAGGGGAT
CTTTGAGAGTATGGTAAGCTTGATTAAGAGTTGATGACTGTTCACTACCTTGTTGGGCCA
TGTCTGGATGGTGCTGTGCTTGTAATTGCCTATACTCCTTCCTTAATCTGGATTGATCGA
TAGTCCAAATGGGTAGCTTTTTGGGGAAGGTCTTTGGGAACAGCTCGTAAAATGTAGAAG
TGAATCTTCGTTGAACCAAGTATTTCAACATTGTGCTTGTGGGGCTTCTTGATACCTGTT
TCCATTATCAGCCTCAGCCTTTAATTTCGCATCATCTTTTTAGTTTCCTTTTCTTTTTCG
TTTTTTTTTTACCTATTGTTAAGAATTACGCTGTGAGTTTCATTGCTATTGTTACAAAAG
ACAAGATAGTCTCAAGATACAACTGAGAAGAAGCACAATT
Chromosomal Coordinates Chr VII from 459854-461365
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator