Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ERJ5
Systematic Name YFR041C
Description Type I membrane protein with a J domain is required to preserve the folding capacity of the endoplasmic reticulum; loss of the non-essential ERJ5 gene leads to a constitutively induced unfolded protein response
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YFR041C	14318566 upstream sequence, from -1000 to -1, size 1000
GGAAATTCCTAATGAAATGCCCCTCGAACAAATAATTAGGAATTTGCAAAGTGCAAGGCT
AAAATATAAGTCTATCGAGAATAGTAGTGAAGCTGATGCTTTTGCAAATGAAATGGCTGA
CGAACTATCCAGATATTTATGAGTATGTACAGATATGTATATGTGTATACATATGTATTA
AACCAATAAGATTGCTCATTTTGTTAATAGTTTTTTGTATGCTGTTAGTAGTACAGGGAA
GTATGCTAGTAAAACCACCCTGTTGATTATGTCCAAAGTCGGGGTAGAATGATAGTTCTT
AACCTGGATATTTAATAGTAGCAATGCAAATTCACTCAGGTAGAGAATTGGCAATGTAAC
AAATGTGTTAACCTTCCATACAAGTGTTCTTTCCTTTACGCCCTTACGTTTAAAAAGTTT
GCACCAATGGCAATATGCCTGTGATAAAGATAAGGAAATAATGAAACTAGAATATGATGC
ATTCTTGAGGATCAATGCATGCTCATAATCGTCATAAAAATGGATCACGCTGACTAAATA
GATAAAATTTAGGTCTTTCAAAAACGTTCTTGAAAGCAAACCATATTTGAACCCGTGGAA
TCTAAGCAACCAAATAACTTCCATGATGCTGGAATAAAACATCAAATATATCAAGAATTC
GTGGATTCCTCCCGGTAAAAACCGAGACCCTACCAGTGGCATTAATATCAGCCACCGTAT
CAATAATGCAGCATACAAAAAGCTTGTGGCTAATTGATAATACTGATAAAGCTTATGCGT
CAACTTGATACCTGCCATCCTCAATGCTAGTTAAATATATGTGACCGAACAAATACTTTT
ATTGACGTTGTATTTACATTATTTCCCAATTTGAAGGTAAATCATATTTAATTTCCATAT
TCAAAATTAATAATCACGAAAAAAATGAGATTTTCAAAATAACACGTACCAAAAGAATAG
AAAACGAACAAAAAATCAAGGTTACAAGATCACTAAAAGA
Chromosomal Coordinates Chr VI from 238255-237368
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator