Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name RPL2a
Systematic Name YFR031C-A
Alias RPL5B
Description Protein component of the large (60S) ribosomal subunit, identical to Rpl2Bp and has similarity to E. coli L2 and rat L8 ribosomal proteins
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL2A	14318555 upstream sequence, from -1000 to -1, size 1000
AAATTACTGCCGCTTTGGTCACTTTGCAATCTGAAACCCCAATTGGGGACATTTGTGACA
GTGTGGCCAAGACAGCTACTTTGAGGGGCAAATCGATAATAGTGAAGCCCGCTTACGTCT
CTAAGATTCAAGAAATTAAACAATTGGTCAAGGACAACTTAACCAATGCGCGCGACCCAC
CTCCAGCAGCATTGGCAGAGCCAGCGCCAGCGCCAGCGCCAGTAGAGCCAGCGGAGCAAG
TGCAGGAAGGGCAAGACAATGCGGAAACCAATGATGTCCCACCTCCGCCTGCTTCGTCTT
CCGATCGTCCAACCGTGGCTGCTACTTAGATCTTTATAAAATTGAAAAGGGGGTATAAAC
AGTGAGAACTTAACATAAAATACATATATTCGTTTATTGCTAAGTAAACTAAAATTGATC
TATTATTTTTCTTTTCTTTTCTTTTGCGGCTGGGGGAACCCCTTTTAAGACAAAATAAGA
CTTTTTTCACCCGTACATTTTTAACACCCAATTCCTTTCCGGCTCCAACTTTCTTTTTTT
TTCGAAAATGATGAGCTTAGTCCTGCGTCCGCTTCCCAAAGAAAAAATGCGTAAGCCTCT
TTCACTTCGGCAGCTCACTCTTCCCACTTTCCCTGTATTCGAAGGTACCGTAGGCAGAGG
CCTATCCTCATTCTCCCACTGTGTAAACTAGGCGTTCTGCCTAGCGGCTAAGCGTTCTCC
GCGTATTGTTTCACCGTTGGGCCTACGGTCGATGGTTTGGCATTGCTCTGCACGATCAGA
TCAATCTGGAATAGTATGGGAATTGCCAAACGCAGCACCAGTGCACATGGATGTGAACCT
ATGGATTACTACGCAATGCACTATCGCATAGGCATAATCGATTGAACCCTGCCCCTCCCC
TCCTTCAATATCATTACCTCGTTTTTTTTATTATTGGGTCATTTTTTAGCGACTAATAAC
CATTTCTGAGCAAACTAAGAAACCATTAGATCAATAAGCA
Chromosomal Coordinates Chr VI from 221267-220507,221418-221415
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator