Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name ECO1
Systematic Name YFR027W
Alias CTF7
Description Acetyltransferase required for establishment of sister chromatid cohesion; modifies Smc3p at replication forks and Mcd1p in response to ds DNA breaks; has a C2H2-type zinc finger; mutations in human homolog ESCO2 cause Roberts syndrome
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ECO1	14318550 upstream sequence, from -1000 to -1, size 1000
TTTGCCGCGCAGCCTGTGTAAAATGGCGCACACAATCACGTTACTTGAATCTCAGTTCAG
AAGTTTCTTTCAACACAGCCAATTGCATTTAGTCTGCTATGCTTAATATTGTAGCTACTA
CGTGGCAAACATAGCTGCCCGAACTACTTTATGCGTACGTGTCCACAGCAATTTGTATAA
CGACTCAATCAAAATTCTCTCAAACACCTTCATGGGAATCTGTCGACAATGTAATCAGAT
CTCAGCCCAATTGCCAGTATGTGTTCATATCTTATTCCGTGGCCGCCCCTCCAAAAAGCT
TCAAAATACACTCACCAGGCTTACTTCTTGTTGGGAGAAGAACCGTTATCGTTCACTTGA
TAATATTCCTACCAGTATGTTGTCCTATATGGAGTCATGAGCATACATGGTGCAAAATTA
TGGAATTAGCGCAATGAGTTTCAAACAGCAATTTGATCTTTTTATAAACACTGAAATGCC
AGAATTGATAATGTAATAGGAAAAAAAAATGAAAAGATTCAAAACCGAAGATAAAATGAG
ATTATTTTTTTCTTTTATGTAGAAACATCGATTCGCTTCTGTGGGTTCCCATATCCTCGA
GGAGAACTTCTAATATATTCTGTATAATTAATATTATAGCATTAACAACGGTATAATCTC
AGTCATTATCCCAAAATTCACCTATTTTCCCATCATACCGATCTTTGCGAATACTTGAGC
ATGTAAATCAGAGATTCTATGTAACAGCTGCCCAGAAACCAGAAAACGTCTCTTAACCAC
TTCCATTGTTGGCATGTTGAAACCTCCTGCCGCCTTGATCATCCTTCGACTTAGGGAAGA
ATCTTAACAAATGAAATTTAACGTCAACGCGTAATAGAAAAAAAGCCTTTCGCGTACTGT
AATCAGTAATAATACATAAGGAGATGCCAGCTACAACGGACATCAACATATATCTATGTT
TACATATTAGGGTTCAACAGAATATAAATCGTTGCACAAA
Chromosomal Coordinates Chr VI from 207452-208297
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator