Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name DNF1
Systematic Name YER166W
Description Aminophospholipid translocase (flippase) that localizes primarily to the plasma membrane; contributes to endocytosis, protein transport and cell polarity; type 4 P-type ATPase
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DNF1	6321014 upstream sequence, from -1000 to -1, size 1000
CCACAACAAATGAACCCAATGGGCGGTATGCCAAAGAACGGCATGCCACCTCAATTTAGA
AATGGTCCGGTTTACGGCGTCCCCCCACAAGGTGGTTTCCCAAGAAATGCCAACGATAAC
AACCAATTTTATCAACAAAAGCAAAGACAAGCTTTGGGTGAACAATTATACAAGAAGGTT
TCTGCTAAGACTTCAAATGAAGAAGCAGCTGGTAAAATTACTGGTATGATTTTGGATTTG
CCACCTCAAGAGGTCTTCCCATTGTTGGAAAGTGATGAATTGTTCGAACAACACTACAAA
GAAGCTTCTGCTGCCTATGAGTCTTTCAAAAAGGAGCAAGAACAACAAACTGAGCAAGCT
TAATGCTCTATGTAATCACCTACTTCCCTACTCAACAAACTTATCATCTTTTTTTTCTCC
CTTCCCTTTTTTTTTTGTCTTAAATACTAGTTATTATCCTTTGTAACCTAAATACTCGCT
CTTATTGACAAAATGCAAACGTTTTTTGTTTTTAACTGTCAAGAGAAGTATCATTTTACT
ATTATTAGACTTCATTACTGAGTTTATTAGTTGCGTTTTTTTGAGGTCTCATTATTAACG
GCAGAATGTTAGTTTTCGCGGAAAATAAACAAAATAGCACGGAAAAAAGACCAACAGGTT
CCAGGAAAATACTAATTTACAAAAAATTGACAAATCAAGTGAGGGTACCTTGCTATTCAT
CACCGCATTCAACTAACTGGAGGTACAAAGCTGATAAAATTTCACAGAGCAAAGTCTCAC
TTAGCTTTTACTTTATGAAATTTGACCTTTAATAACCGAAGGTCATCGTAATACGCAACT
CAGACAGTTTTAAGTGGATTTTTAGGGTCGCAATTAAAAACACTCAAAAATTAACCGGAG
GTTGAGCAAGGGAAAGCAACCGTAACAGAAATCCTTTATTTCCTCCTGGAAGTGAAATAA
AAACGCAGTTAACTTTAAAAAGGAAAGTTAGTTGATAATT
Chromosomal Coordinates Chr V from 512744-517459
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator