Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name BEM2
Systematic Name YER155C
Alias IPL2, SUP9, TSL1
Description Rho GTPase activating protein (RhoGAP) involved in the control of cytoskeleton organization and cellular morphogenesis; required for bud emergence
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BEM2	6321003 upstream sequence, from -1000 to -1, size 1000
TTCCCGGGATTATTTCAGGTATGAATCCTAACTGGAACGAAGACACTTCCGATGAGTCTT
TTGACAGATGCTTTGCTCGCGCAAGTGAGTTTATCGGTGGGGTCTTTGTCACATTGGTAA
GAGGCTACGGTCAATCGTGGTTGCCAGCCAAGGCCCTTGTGGCGCAAGCCATTGATGAAA
GAATGGATGTTGATAAGAGTGGCAAAATCATTGTCTTGCCCCAATTCTGTCCATGGAAGG
AGCATCTATACGAGCTGGAAAGAGAGAAGAACATTGAAAAGCAAATCGAGTTTGTTCTCT
TCACAGACTCTTCTGGTGCCTGGAGGGTATCTACTGTACCAATCAACTCCACCTCCTTCC
AGTTTAGGAGAGGTTTGCCGGAGCCATTAAGAGGCCTCAGAGACGAAGAGCTGAGCACCA
AGAGCGGTGTGCCAGGATGTATCTTCATTCATGCAGCAGGTTTCATTGGAGGTGCCAAGT
CCAAAGAGGCTGTATATGAGCTGGCTAAGATGTCTTTGGCCTAGTCGGGAGCGAGCGCTC
AGTCAGGTCCCTTATCTATTTAATAATATTTAACAATTCCACTATTTATTCTGTATAGTA
AGTAAATCTTTAATGCAAGCAAAAATCTTCCCGCCGCGAATCCTGAAACATATTCCCCTC
GGTGAAACACGCTCTTGAAAATGACCTGAGAACACAAGATATCAGACGGCTCTTGTTGCA
CAAAAAACAAAAACAAAAGAAGCAAGCTACGTTGCAGCCACTGGTACTGTCTGCTAACTC
AAACATTCTTTTTCATTTTTAATATACAGATTTCGTATTCTCCCGTTCCCGCTATACGCA
ATTTTCTTTCTTTTTTTTCCCTCTTTGGTTAGGAGACTGCAGATCAGTCCCATTTTTTCC
AACAGAACAAACAAGCAAACGTTTCAGTTTAAAAGAACACACGGTCGTCGTGCCTTTTCT
GGATAGACACAAAAAAAACAAATAACGAAGCAGGAGTCTA
Chromosomal Coordinates Chr V from 482848-476345
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator