Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name GLC7
Systematic Name YER133W
Alias CID1, DIS2, DIS2S1, PP1
Description Type 1 serine/threonine protein phosphatase catalytic subunit, involved in many processes (eg: glycogen metabolism, sporulation, mitosis); accumulates at mating projections by interaction with Afr1p; interacts with many regulatory subunits
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GLC7	6320980 upstream sequence, from -1000 to -1, size 1000
AGTGGGTGAATTTTGAGATAATTGTTGGGATTCCATTTTTAATAAGGCAATAATATTAGG
TATGTAGAAAGTACTAGAAGTTCTCCTCGAGGATTTAGGAATCCATAAAAGGGAATCTGC
AATTCTACACAATTCTATAAATATTATTATCATCATTTTATATGTTAATATTCATTGATC
CTATTACATTATCAATCCTTGCGTTTCAGCTTCCACTAATTTAGATGACTATTTCTCATC
ATTTGCGTCATCTTCTAACACCGTATATGATAATATACTAGTAACGTAAATACTAGTTAG
TAGATGATAGTTGATTTTTACTCCAACAAAAGAATTACAGTCAGTGGCTGTTTGCTGACA
TTTCATTGCTTCCCTTACAACCTGATTTCCATTCGAGTTGAAAGGTTGAGAAAAATTGCA
AGACTTCTCTCTCATCTACCTTCCCCTTTTCTTGAAGACAAGGTGAGAGACAATTTAGTA
CTAAAGCTTTTGCGGTTGTTATTCAATTGAGGTAGATACCTGGCAAAACATTTCTTGTGA
GCACAACCTCAATTAAAGTTAGACAAGTAGGTGCACTATTGGTTGCTTGTTGGCTCATCT
CGTTGAGGAATGTAATAACTACTTGTTATTAACCTGTTTTTGTGCCATCTATAGTGGAGA
GCTTATTGCAATTTGTTTTTTATTTCTTGACTGCATATATCAGTCTTTGACAGGCTGCAT
GGGGATGACAGTTAGAAACTAGCCAAATTACCCCTTATGTAGATAACAATCATTGCTTAT
TCGCTCTTCCCCCATTTTTTTTCTTGCTCTTGCTGTTTTTTCTTTTAGCGTTCGTTTCAA
GGAACAAGAGAGGGAAAAAAAAATCAAAAGTAGAAAAGAAGAAGAAAAAAACAACGTAAC
ACAAGTTAACACCACAACTGAAAAAAAAAATAAGAGGTGAACGAACGAGTAACTGGGGAG
AGGAAAGCAGATTACCACAATATACATTCAAATTAAAGAA
Chromosomal Coordinates Chr V from 432495-432671,433197-433958
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator