Yeastract IST KDBIO/INESC-ID BSRG/IST
Home > Go Back > View Contact Us     Tutorial     Help

 

Locus Information

orfgene link protein link go link menu
Standard Name YCK3
Systematic Name YER123W
Alias CKI3
Description Palmitoylated, vacuolar membrane-localized casein kinase I isoform; negatively regulates vacuole fusion during hypertonic stress via phosphorylation of Vps41p; shares essential functions with Hrr25p; regulates vesicle fusion in AP-3 pathway
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YCK3	7276233 upstream sequence, from -1000 to -1, size 1000
TTTTTGCCAATTAGAGAAAAAATCGTCAACACTATTTTCTTTGGAAGTCGACCTGGAAGC
GTCTGAATCGGTGTCCAACGGTGAGTCCGAAGAATCTTGACCGTTCAAGACTAATTCTGA
TGGGTATAACTCCATATCCTTTTGAACCTTCTTGTCGAGATGTATCTTATATTTCTTAGC
AACAGGGCTCGTATATTTTGTTTTCGCGTCAACATTTGCTGTATTTAGTAGCTGTTTCCC
ATTGTTCTTTAAGAAAAAATCACGAGCCTTATGGTTCCCACCCAACTTAAACCTTCTTAA
ATTGTTAATTGTCCATTTATCTAATGTAGAAGACTTTACAAAGGTGATATGAACACCCAT
GTTTCTATGCACAGCAGAGCATTGAATACACAGCATCACACCAAAAGGTACCGAAGTCCA
AGTAGGATTCTTGTTACCACAATCAAAACAAACTCGATTTTCCATGTTGCTACCTAGCTT
CTGAAAAACTTGTTGAGTAGTCTGTTCCGTGGCAAATGTTTCTCCTTCATCGTTACTCAT
TGTCGCTATGTGTATACTAAATTGCTCAAGAAGACCGGATCAACAAGTACTTAACAAATA
CCCTTTCTTTGCTATCGCCTTGATCTCCTTTTATAAAATGCCAGCTAAATCGTGTTTACG
AAGAATAGTTGTTTTCTTTTTTTTTTTTTTTTTTCGAAACTTTACCGTGTCGTCGAAAAT
GACCAAACGATGTTACTTTTCCTTTTGTGTCATAGATAATACCAATATTGAAAGTAAAAT
TTTAAACATTCTATAGGTGAATTGAAAAGGGCAGCTTAGAGAGTAACAGGGGAACAGCAT
TCGTAACATCTAGGTACTGGTATTATTTGCTGTTTTTTAAAAAAGAAGGAAATCCGTTTT
GCAAGAATTGTCTGCTATTTAAGGGTATACGTGCTACGGTCCACTAATCAAAAGTGGTAT
CTCATTCTGAAGAAAAAGTGTAAAAGGACGATAAGGAAAG
Chromosomal Coordinates Chr V from 404813-406387
See documented transcription factors
See potential transcription factors
Open in SGD external link
w3c xhtml validator w3c css validator w3c xhtml+rdfa validator